Overview

Comprehensive Description

Biology

Inhabits steep outer reef slopes exposed to strong currents where it lives in large gorgonians and black corals (Ref. 3921). Benthic (Ref. 58302). Feeds on small benthic or planktonic crustaceans. The suggestion that this species lays demersal eggs (Ref. 3921) is questionable. Pelagic spawning has been observed for this species from field observations (Ref. 26305). Monogamous (Ref. 52884), strongly territorial (Ref. 26305). Uncommon to rare in most areas (Ref. 9710).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and South Africa (Ref. 11228) to the Hawaiian Islands, north to southern Japan, south to New Caledonia. Eastern Pacific: Gulf of California to northern Colombia and the Galapagos Islands (Ref. 9289).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 13; Analspines: 3; Analsoft rays: 7
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

13.0 cm TL (male/unsexed; (Ref. 9289))
  • Bussing, W.A. and R.J. Lavenberg 1995 Cirrhitidae. Chinos, halcones. p. 1007-1010. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9289)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by white color with pattern of red stripes and bars; lower 5-6 pectoral rays unbranched; greatly elongate and pointed snout; absence of palatine teeth; coarsely serrate posterior margin of preopercle; elongated body, greatest depth 4.4-4.6 in SL (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Oxycirrhites typus
Catalog Number: USNM 93172
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Corandagos Id. (NW), N 30 Degrees E., 5.7 Miles; Eastern Palawan and Vicinity, Corandagos Island, Palawan, Philippines, Pacific
Depth (m): 93 to 93
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 100 m (Ref. 9710), usually 0 - 25 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 30 - 110
  Temperature range (°C): 19.490 - 28.798
  Nitrate (umol/L): 0.094 - 22.430
  Salinity (PPS): 34.240 - 35.034
  Oxygen (ml/l): 1.431 - 4.549
  Phosphate (umol/l): 0.187 - 1.826
  Silicate (umol/l): 1.094 - 17.402

Graphical representation

Depth range (m): 30 - 110

Temperature range (°C): 19.490 - 28.798

Nitrate (umol/L): 0.094 - 22.430

Salinity (PPS): 34.240 - 35.034

Oxygen (ml/l): 1.431 - 4.549

Phosphate (umol/l): 0.187 - 1.826

Silicate (umol/l): 1.094 - 17.402
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore; often associated with black coral (Ref. 75154). Feeds on invertebrates (Ref. 3921).
  • Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p. (Ref. 3921)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 52884). Actual spawning lasts about 1-2 seconds while ascending a distance of less than 0.25 m (Ref. 26305). Courtship and spawning behavior is similar to that described for other species: 1) courtship commences just before or after sunset with spawning after sunset; 2) successive courtship and spawning by the male in social groups containing one or more females; 3) courtship and spawning at a site common to both male and female or at a site located within the female's home area; 4) pelagic spawning with a rapid but relatively short ascent into the water column by both male and female; 5) return of the male and female to resident corals afte spawning.
  • Donaldson, T.J. and P.L. Colin 1989 Pelagic spawning of the hawkfish Oxycirrhites typus (Cirrhitidae). Environ. Biol. Fish. 24(4):295-300. (Ref. 26305)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:7
Specimens with Sequences:7
Specimens with Barcodes:7
Species:1
Species With Barcodes:1
Public Records:6
Public Species:1
Public BINs:1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oxycirrhites typus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCTTGAGCTGGCATAGTCGGCACAGCCCTTAGCCTACTTATCCGGGCAGAACTTAGCCAACCCGGGGCCCTTCTCGGGGACGACCAGATCTACAATGTAATCGTTACGGCACACGCCTTTGTAATGATTTTCTTCATAGTAATACCAATTATAATTGGGGGCTTTGGCAACTGGCTTATTCCCCTAATAATTGGAGCCCCTGATATGGCATTTCCCCGAATAAATAACATAAGCTTCTGACTACTCCCTCCCTCATTCCTACTACTCCTAGCCTCGTCTGGTGTAGAAGCCGGAGCAGGTACCGGTTGAACTGTTTACCCGCCCCTCGCCGGCAATTTAGCTCATGCGGGAGCATCTGTAGATCTAACTATTTTTTCTCTTCACTTAGCAGGAATCTCTTCTATCCTAGGGGCTATTAACTTTATTACAACTATTATTAACATAAAACCCCCTGCTATTTCCCAATATCAAACCCCATTGTTTGTATGAGCAGTACTAATTACTGCCGTGCTTCTTCTACTCTCCCTCCCAGTTCTCGCTGCCGGCATTACTATACTATTAACCGATCGTAATCTAAATACAACCTTTTTCGACCCCGCGGGAGGGGGGGACCCGATTCTTTACCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oxycirrhites typus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Baensch, H.A. 1992 Neue Meerwasser-Praxis. Tetra Verlag, Melle, Germany. (Ref. 7309)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!