Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Brief Summary

Biology

In the common blue, the number of generations produced each year varies depending on the geographic location of the population. In the majority of England and Wales there are two broods per year (the populations are 'bivoltine'), with adults on the wing in May and June and again in August and September. Populations in Scotland and parts of England to the north of Yorkshire are single-brooded ('univoltine'); adults are present between June and September, with emergence occurring earlier in warmer areas. Occasionally, in warm years, double-brooded and single-brooded populations may go on to produce an extra brood in the same year, thanks to the warm weather. This phenomenon indicates that the factors governing the number of broods produced are environmental, rather than genetic (4).  The eggs are laid singly on the foodplants and take around a week to hatch (3). Caterpillars of the first generation (or of the only generation in single-brooded populations) take around 6 weeks to become fully developed. Second brood caterpillars overwinter when partly grown, and complete their development during the following year (3). Pupation occurs either at the base of the foodplant or amongst litter on the ground (4) and adult butterflies emerge after around two weeks (3).  In common with many other species of blue butterflies, the caterpillars of the common blue are attractive to ants when they are fully grown. The pupae are also attractive to ants and are often carried away into ant nests (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common blue is the most widespread of the blue butterflies in Britain (4), and as the name suggests, it is one of the most common butterflies in Europe (5). The males are a striking bluish-violet colour, but females are brown with orange spots near the margins of the wings. In both sexes, the undersides of the wings are greyish brown with blackish spots and orange crescents towards the margins of the wings (2). The caterpillar has a stout body, which tapers towards the tips. The head is black and the body is green. A darker green line bordered with white passes along the centre of the back. There is also a whitish-green line along the sides (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Size: 28-36 mm. The underside margin of both wings with complete row of orange lunules. The underside of the forewing has two black spots near base. The male is violet-blue with black marginal line; while the females is brown with variable degrees of blue suffusion and orange in the hindwing marginal spots centred with black.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Records

6 records. Latest in 1975 (South Sinai)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Sinai, and Cairo. AOO = 25 km2. EOO = 41,500 km2. 3 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (North Africa and Europe to Afghanistan)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This butterfly is found throughout Britain and occurs on most off-shore islands including the Outer Hebrides and Orkney (4). It is most numerous in the south of England and Wales and is scarce in areas at altitudes of over 300 meters, becoming absent over 500 m (4). Elsewhere, the range of this species extends throughout Europe, North Africa and in temperate parts of Asia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

Taxonomy

Needs revision

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Meadows and open spaces up to 2000 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in a wide range of grassy habitats where the foodplants occur. The main foodplant is common bird's foot trefoil (Lotus corniculatus), although other trefoils, clovers (Trifolium) and related plants may be used (2) (5). This species tends to be found in sunny, sheltered areas, and typical habitats include downland, woodland clearings, coastal dunes, road verges, golf courses, cemeteries and occasionally gardens (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Host-plants: Leguminous plants, probably Medicago.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
larva of Aplomya confinis is endoparasitoid of larva of Polyommatus icarus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

In weak sunlit conditions males often bask on low herbage, with wings held half open. In overcast but warm conditions they sometimes bask with wings fully outspread.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The Flight Period

April-July

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

.Two generations in most years, three in good years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polyommatus icarus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 45 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATAATATAGGATTCTGATTATTACCTCCATCATTGATTCTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGGTTATCCCCCACTTTCATCTAATATTGCACACAGAGGATCTTCTGTAGATTTA---GCAATTTTCTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGA---GCAATTACTATATTATTAACTGATCGAAACCTCAATACCTCATTCTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCGGGATTTGGTATTATTTCTCACATTATTTCTCAAGAAAGTGGAAAAAAA---GAAACTTTTGGAGCCCTAGGTATAATTTATGCAATATTAGCCATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACTCGAGCTTATTTTACTTCAGCTACTATAATTATTGCAGTACCTACAGGAATTAAAATTTTCAGTTGACTA---GCAACTATTTATGGGACA---CAAATTAATTATAGGCCTTCAATACTTTGAAGATTAGGTTTTATTTTCTTATTTACAGTTGGAGGATTAACAGGAGTAATTTTAGCTAATTCTTCAATCGATATTACACTACATGACACATATTATGTAGTTGCTCATTTCCACTATGTT---TTATCTATAGGAGCAGTATTTGCAATTTTTGGGGGATTCATCCACTGATATCCTTTATTTACAGGTTTATACTTAAATAATTATTTATTAAAAATTCAATTTATTATTATATTTATTGGAGTTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus icarus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 135
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Vulnerable (D2)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© BA Cultnat

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Rare

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is widespread in Europe, North Africa and temperate Asia. It was discovered in Mirabel, Quebec, Canada by Ara Sarafian.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not threatened (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Blue

The Common Blue (Polyommatus icarus) is a small butterfly in the family Lycaenidae, widespread over much of the Palaearctic and recently introduced[1] in eastern Canada.

The larva feeds on Leguminosae. Recorded foodplants are Lathyrus spp., Vicia spp., Vicia cracca, Oxytropis campestris, Lotus corniculatus, Trifolium pratense, Oxytropis pyrenaica, Astragalus aristatus, Astragalus onobrychis, Astragalus pinetorum, Medicago romanica, Medicago falcata, and Trifolium repens.

Contents

Subspecies

  • P. i. mariscolore (Kane, 1893) Ireland
  • P. i. fuchsi (Sheljuzhko, 1928) South Siberia, Transbaikalia
  • P. i. omelkoi Dubatolov & Korshunov, 1995 Amur, Ussuri
  • P. i. ammosovi (Kurenzov, 1970) Central Yakutia, Far East, Kamchatka
  • P. i. fugitiva (Butler, 1881) Pakistan
  • P. i. napaea (Grum-Grshimailo, 1891) Tian-Shan

U.K. and Ireland

Appearance, behaviour, and distribution

Male uppersides are an iridescent lilac blue with a thin black border. Females are brown above with a row of red spots along the edges and usually some blue at the base of the wings; the upperside may be mostly blue, especially in Ireland and Scotland, but it always has red spots. Undersides have a greyish ground colour in the males and a more brownish in the females. Both sexes have a row of red spots along the edge of the hindwings and extending onto the forewings, though they are generally fainter there, particularly in the males, where they are sometimes missing altogether. There are about a dozen black-centered white spots on the hindwings, nine on the forewings. These usually include one in the middle of the forewing cell, absent in Chapman's and Escher's Blues.[2] The white fringe on the outer edge of the wings is not crossed with black lines, as it is in the Chalkhill and Adonis Blues.

The Common Blue is Britain's (and probably Europe's) most common and most widespread blue, found as far north as Orkney and on most of the Outer Hebrides. Males are often very obvious as they defend territories against rivals and search out the more reclusive females. A range of grassland habitats are used: meadows, coastal dunes, woodland clearings, and also many man-made habitats, anywhere their food plants are found.

Recently, this butterfly was discovered in Mirabel, Quebec, Canada by Ara Sarafian, an amateur entomologist who observed the butterfly from 2005 to 2008. He contacted the Canadian National Collection of Insects in Ottawa where the butterfly was identified as P. icarus, a new alien butterfly to Canada and to North America. The butterfly seems to be well established and is extending its range from year to year.[1]

Lifecycle and food plants

The main food plant on most sites is Bird's foot trefoil (Lotus corniculatus). Others used include Black Medick Medicago lupulina, Common Restharrow (Ononis repens), White Clover (Trifolium repens), and Lesser Trefoil (Trifolium dubium). Eggs are laid singly on young shoots of the food plant.

The caterpillar is small, pale green with yellow stripes and, as usual with lycid larvae, rather slug-like. Hibernation occurs as a half grown larvae. They are attractive to ants, but not as much as some other species of blues. The chrysalis is olive green/brown and formed on the ground, where it is attended by ants, which will often take it into their nests. The larva creates a substance called honeydew, which the ants eat while the butterfly lives in the ant hill. In the south of Britain there are two broods a year, flying in May and June and again in August and September. Northern England has one brood, flying between June and September. In a year with a long warm season, there is sometimes a partial third brood in the south flying into October.

Gallery

Lifestyle

  • Diet, caterpillars: leaves of plants
  • Diet, Butterflies: wildflower nectar, excrement
  • Lifespan: 3 weeks as butterfly

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!