Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Known prey organisms

Passalus cornutus preys on:
rotting wood
Pinus

Based on studies in:
USA: North Carolina (Forest, Plant substrate)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Odontotaenius disjunctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTACTATTAGCTAGAAGATTTATTGAGTCAGGGGCGGGAACAGGATGAACAGTTTACCCTCCTCTTTCCAGTAATATTGCCCACAGTGGAGCCTCAGTAGATTTAACAATTTTTAGCCTTCATTTGGCAGGAATCTCTTCAATTTTGGGAGCAGTTAATTTTATCTCTTCAATTATAAATATACGAACCCCTGGAATAACAATAGAAAAAATACCTTTATTTGCTTGATCTGTAGGAATTACTGCCGTTCTATTACTTCTTTCTCTCCCAGTATTAGCAGGAGCAATTACAATACTTTTAACCGATCGAAATTTAAATACCTCATTTTTTGACCCAACCGGAGGAGGAGACCCAATTTTATATCAACACTTATTTTGATTCTTTGGACATCCTGAAGTTTACATTTTAATTCTCCCTGGATTCGGAATAATCTCCCATATTATCAGTCAACAAAGAAATAAAAAAGAAACCTTTGGAGCATTAGGAATAATCTACGCAATAATAGCTATTGGTCTTCTAGGGTTTATTGTATGAGCTCACCATATATTTACTGTAGGAATAGATGTTGATACGCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Odontotaenius disjunctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Odontotaenius disjunctus

The patent-leather beetle or "Jerusalem beetle" (Odontotaenius disjunctus) is a beetle in the family Passalidae which can grow to just over an inch-and-a-half long. They are shiny black and have many long grooves on their elytrae. They have a small horn between their eyes, and clubbed antennae. When disturbed, adults produce a squeaking sound by rubbing their wings on the abdomen.This is called stridulating and is often easy to hear. This is apparently used for communication between members of the colony, possibly to communicate danger to other beetles.

Patent-leather beetles are usually found under, or inside, old logs or stumps. They eat old decaying wood. These beetles make tunnels in the wood; inside the galleries, the beetles will mate, lay eggs, and raise their young. The adults feed the larvae a chewed-up mixture of wood chips and feces. The larvae cannot feed themselves and take a year to develop.

Adult beetles are often covered by mites.

Many patent-leather beetles may live together in a colony in the same log. Adults can live over a year. Patent-leather beetles like to eat logs of certain trees. Mostly they eat deciduous trees, such as oaks and elm. Wood inhabited by these beetles is usually well decomposed and falls apart readily.

The patent-leather beetle is considered beneficial in its activities to decompose dead wood, and is harmless to humans.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!