Overview

Brief Summary

The Violet Copper is a rare butterfly that is often confined to very small sites, where it may be seen in large numbers. It is found in swampy, wet grassland with sufficient wind shelter (shrub, forest edges) and rough vegetation bordering streams and lakes. In Central Europe, eggs are laid on the underside of the leaves of Bistort (Polygonum bistorta). In Transylvania mostly humid or damp oak forest clearings with mosaic-like vegetation. In the north of its range Viviparous Bistort (Polygonum vivipara) is also used as larval foodplant. The young caterpillars eat the lower epidermis, thus making the characteristic “windows”. It passes the winter as a pupa. Its western populations have one, the eastern populations mostly two generations a year. Habitats: humid grasslands and tall herb communities (37%), alpine and subalpine grasslands (10%), water-fringe vegetation (8%), fens, transition mires and springs (8%), dry calcareous grasslands and steppes (5%), mesophile grasslands (5%).

  • Bauerfeind SS, Theisen A, Fischer K (2009) Patch occupancy in the endangered butterfly Lycaena helle in a fragmented landscape: effects of habitat quality, patch size and isolation. Journal of Insect Conservation 13: 271-277. doi: 10.1007/s10841-008-9166-1
  • Finger A, Schmitt T, Zachos FE, Meyer M, Assmann T, Habel JC (2009) The genetic status of the violet copper Lycaena helle - a relict of the cold past in times of global warming. Ecography 32: 382-390. doi: 10.1111/j.1600-0587.2008.05766.x
  • Fischer K, Beinlich B, Plachter H (1999) Population structure, mobility and habitat preferences of the Violet Copper Lycaena helle (Lepidoptera: Lycaenidae) in Western Germany: Implications for conservation. Journal of Insect Conservation 3: 43-52. doi: 10.1023/a:1009630506216
  • Habel JC, Augenstein B, Meyer M, Nève G, Rödder D, Assmann T (2010a) Population Genetics and Ecological Niche Modelling Reveal High Fragmentation and Potential Future Extinction of the Endangered Relict Butterfly Lycaena helle. In: Habel JC, Assmann T (Eds). Relict Species. Springer Berlin Heidelberg: 417-439. doi: 10.1007/978-3-540-92160-8_25
  • Habel JC, Finger A, Schmitt T, Nève G (2011a) Survival of the endangered butterfly Lycaena helle in a fragmented environment: Genetic analyses over 15 years. Journal of Zoological Systematics and Evolutionary Research 49: 25-31. doi: 10.1111/j.1439-0469.2010.00575.x
  • Habel JC, Rodder D, Schmitt T, Neve G (2011b) Global warming will affect the genetic diversity and uniqueness of Lycaena helle populations. Global Change Biology 17: 194-205. doi: 10.1111/j.1365-2486.2010.02233.x
  • Habel JC, Schmitt T, Meyer M, Finger A, Rodder D, Assmann T, Zachos FE (2010b) Biogeography meets conservation: the genetic structure of the endangered lycaenid butterfly Lycaena helle (Denis & Schiffermuller, 1775). Biological Journal of the Linnean Society 101: 155-168.
  • Martín Cano J, García-Barros E, Munguira ML (2009) Lycaena helle (Dennis y Schiffermüller, 1775). In: Verdú JR, Galante E (Eds). Atlas de los Invertebrados Amenazados de España (Especies En Peligro Crítico y En Peligro). Dirección General para la Biodiversidad, Ministerio de Medio Ambiente, Madrid: 180-184.
  • Meyer M (1981) Révision systématique, chorologique et écologique des populations européennes de Lycaena (Helleia) helle [Denis; Schiffermüller, 1775]; (Lepidoptera: Lyceanidae). Linneana belgica 8: 238-260.
  • Meyer M, Helminger T (1994) Studies of a population of Lycaena helle arduinnae Meyer, 1980 in the northwestern Oesling region (Lepidoptera: Lycaenidae). Bulletin de la Société des Naturalistes Luxembourgeois 95: 315-326.
  • Steiner R, Trautner J, Grandchamp A-C (2006) Larvalhabitate des Blauschillernden Feuerfalters (Lycaena helle) am schweizerischen Alpennordrand unter Berücksichtigung des Einflusses von Beweidung. In: Fartmann T, Hermann G (Eds). Larvalökologie von Tagfaltern und Widderchen in Mitteleuropa. Westfälisches Museum für Naturkunde, Münster: 135-151.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lycaena helle

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACTTCTTTAAGAATTTTAATTCGTCTTGAATTAGGTACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTATTACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCCAATATTGCTCATAGTGGATCATCCGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATATCTTTATTTATTTGAGCTGTAGGTATTACAGCTTTATTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lycaena helle

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lycaena helle

The Violet Copper (Lycaena helle) is a butterfly of the Lycaenidae family. It is found from the Pyrenees to Northern Norway and from Belgium to Central Asia.

Dorsal view
Ventral view

The wingspan is 24–26 mm. The butterfly flies from May to July depending on the location.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!