Molecular Biology and Genetics

Molecular Biology

Barcode data: Satyrium spini

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTCTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTCCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAATACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCAGTTGATCTAGCTATTTTTTCTCTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACTATTATTAATATACGAGTTAATAATTTATCTTTTGATCAAATATCTTTATTTATTTGAGCAGTAGGAATCACAGCATTATTGCTACTATTATCTTTACCAGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAACTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Satyrium spini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Satyrium spini

The Blue Spot Hairstreak (Satyrium spini) is a butterfly in the family Lycaenidae.

Appearance, behaviour and distribution[edit]

The Blue Spot Hairstreak lives in southern and middle Europe up to approximately 54° N. It is not found in the northwest of France, the Netherlands, Scandinavia, Estonia or Latvia. It is also not found in large parts of Italy and on most Mediterranean islands.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!