Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aricia cramera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Aricia cramera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACAAATCATAAAGATATTGGAACATTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCTTAAGAATTTTAATTCGTATAGAATTAAGAACTCCTGGATCTTTAATTGGAGAT---GATCAAATTTATAACACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCATTTGACCAAATATCATTATTTATTTGAGCTGTAGGTATTACTGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATATTAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGANCCAATTTNATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aricia cramera


The Southern Brown Argus (Aricia cramera) is a butterfly of the Lycaenidae family. It is a butterfly of Southern Europe and North Africa and can be found on from Morocco and Tunisia up to Spain and Portugal, on Mediterranean islands including Menorca and on the Canary Islands.

The wingspan ranges to up to 30 mm. The butterfly flies from May to September depending on the location.

The larvae feed on Erodium, Helianthemum and Geranium species.

See also[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!