Overview

Comprehensive Description

Description

Size: 18-22 mm. The underside of the wing like Polyommatus and Plebejus but ground-colour greyish-brown with spots ringed with white; fringes chequered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Records

5 records. Latest in 1920 (Mariut). Benyamini (1984) says ssp nabataeus occurs in North Sinai but gives no details

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Northern Egypt. AOO = 65 km2. EOO =10,700 km2. 3 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Distribution

Narrow (Iberia to Saudi Arabia)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

Taxonomy

Subspecies poorly defined (Larsen 1990) and hence ignored here, but there may be two subspecies, coloniarum Turati on the coast west of Alexandria (probably extinct) and nabataeus Graves in North Sinai

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Trophic Strategy

Host-plants: probably Thymus or Origanum (Labiatae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The Flight Period

April-May

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudophilotes abencerragus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTTTTTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGTATAGAATTAGGAACACCTGGATCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATAGAGGTTCATCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTAAATAATTTATCATTTGATCAAATATCATTATTTATTTGAGCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTTTTAGCGGGTGCTATTACTATATTACTAACAGATCGAAATCTTAATACTTCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudophilotes abencerragus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN

Data Deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abundance

Probably extinct in Egypt

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Changes in land use have probably caused extinction

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudophilotes abencerragus

Pseudophilotes abencerragus, the False Baton Blue, is a butterfly in the Lycaenidae family. It is found on the Iberian Peninsula and in North Africa, Egypt, Israel, Jordan and Saudi Arabia.[2]

The wingspan is 18–22 mm. Adults are on wing from April to May.[3]

The larvae feed on Cleonia lusitanica, Thymus vulgaris, Medicago cf. turbinata, Medicago hispidus, Thymus cf. hirtus, Salvia taraxacifolia and Thymus fontanesii.

Subspecies[edit]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!