Overview

Distribution

Range Description

Occurs in one or two small areas of northwest Spain with the main distribution area being from central eastern France, Switzerland, Germany (absent from the north) and eastwards.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in damp habitats where the foodplant Great Burnet (Sanguisorba officinalis) is found.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phengaris nausithous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phengaris nausithous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Maculinea nausithous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGATTTGAGCAGGAATGCTAGGAATATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTTCAGGATCTTTAATTGGGAATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGCGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCGCGAATAAATAACATAAGATTTTGATTATTACCGCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCGCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCGGGAATTTCTTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATAAAAGTAAATAATTTATTTTTTGATCAAATATCATTATTTATTTGAGCGGTAGGTATTACAGCATTATTATTACTACTATCTTTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACAGATCGAAACCTAAATACTTCATTTTTTGACCCTGCTGGAGGTGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Maculinea nausithous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dusky Large Blue

The dusky large blue (Phengaris nausithous) is a species of butterfly in the Lycaenidae family. It is found in Armenia, Austria, Azerbaijan, Belarus, Bulgaria, Czech Republic, France, Georgia, Germany, Hungary, Kazakhstan, Moldova, Montenegro, The Netherlands, Poland, Romania, Russia, Serbia, Slovenia, Spain, Switzerland, and Ukraine.[1]

Life cycle of this species is strongly related to Sanguisorba officinalis (great burnet).[1]

References[edit]

  1. ^ a b World Conservation Monitoring Centre 1996. Maculinea nausithous. 2006 IUCN Red List of Threatened Species. Downloaded on 6 October 2010
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!