Overview

Brief Summary

The Dusky Large Blue occurs on damp, moderately nutrient-rich grassland and rough vegetation. The butterflies are usually found on or near the foodplant Great Burnet (Sanguisorba officinalis). Having lived on the flowerheads of this plant for a few weeks, the small caterpillars go down to the ground, in order to be carried away usually by workers of the ant Myrmica rubra to an ant nest. There, they remain feeding on ant grubs, hibernating and pupating in the early summer. The newly-emerged butterflies leave the nest. The Dusky Large Blue is one of the most specialized of the “ant blues” being most adapted to one species of host ant. Populations using Myrmica scabrinodis as the main host ant are extremely rare and probably confined to the edge of the range or to east Europe. The Romanian populations belong to the subspecies kijevensis and prefer Myrmica scabrinodis as host ant. The Dusky Large Blue has one generation a year. Habitats: humid grasslands and tall herb communities (36%), water-fringe vegetation (15%), blanket bogs (12%), fens, transition mires and springs (9%), dry siliceous grasslands (6%), mesophile grasslands (6%). In Germany, the Rhone valley and parts of Poland, it supports a beautiful, highly specialized ichneumonid parasitoid Neotypus ‘pusillus’, which possibly consists of two cryptic species centred on Germany-Poland and the Rhone valley, each host-specific to Phengaris nausithous.

  • Anton C, Musche M, Hula V, Settele J (2008) Myrmica host-ants limit the density of the ant-predatory large blue Maculinea nausithous. Journal of Insect Conservation 12: 511-517. doi: 10.1007/s10841-007-9091-8
  • Anton C, Musche M, Settele J (2007a) Spatial patterns of host exploitation in a larval parasitoid of the predatory dusky large blue Maculinea nausithous. Basic and Applied Ecology 8: 66-74. doi: 10.1016/j.baae.2006.03.006
  • Anton C, Zeisset I, Musche M, Durka W, Boomsma JJ, Settele J (2007b) Population structure of a large blue butterfly and its specialist parasitoid in a fragmented landscape. Molecular Ecology 16: 3828-3838. doi: 10.1111/j.1365-294X.2007.03441.x
  • Batáry P, Kőrösi Á, Örvössy N, Kover S, Peregovits L (2009) Species-specific distribution of two sympatric Maculinea butterflies across different meadow edges. Journal of Insect Conservation 13: 223-230. doi: 10.1007/s10841-008-9158-1
  • Dierks A, Fischer K (2009) Habitat requirements and niche selection of Maculinea nausithous and M. teleius (Lepidoptera: Lycaenidae) within a large sympatric metapopulation. Biodiversity and Conservation 18: 3663-3676. doi: 10.1007/s10531-009-9670-y
  • Drechsler M, Watzold F, Johst K, Bergmann H, Settele J (2007) A model-based approach for designing cost-effective compensation payments for conservation of endangered species in real landscapes. Biological Conservation 140: 174-186.
  • Ernst M (1999) Das Lebensraumspektrum der Ameisenbläulinge Maculinea nausithous und Maculinea teleius im Regierungsbezirk Darmstadt (Hessen) sowie Vorschläge zur Erhaltung ihrer Lebensräume. Natur und Landschaft 74: 299-305.
  • Geissler-Strobel S (1999) Landschaftsplanungsorientierte Studien zu Ökologie, Verbreitung, Gefährdung und Schutz der Wiesenknopf-Ameisen-Bläulinge Glaucopsyche (Maculinea) nausithous und Glaucopsyche (Maculinea) teleius. Nachrichten des entomologischen Vereins Apollo, Neue Folge 44: 1-105.
  • Grill A, Cleary DFR, Stettmer C, Bräu M, Settele J (2008) A mowing experiment to evaluate the influence of management on the activity of host ants of Maculinea butterflies. Journal of Insect Conservation 12: 617-627. doi: 10.1007/s10841-007-9098-1
  • Johst K, Drechsler M, Thomas J, Settele J (2006) Influence of mowing on the persistence of two endangered large blue butterfly species. Journal of Applied Ecology 43: 333-342.
  • Lhonoré PJ (1997) L’ amènagement d’ habitats pour une gestion durable des populations des papillons du genre Maculinea (M. alcon, M. teleius, M. nausithous) (Lepidopt., Lycaenidae). Council of Europe Environmental Encounters Series 33, 109–119.
  • Novak J, Skalicky M, Hakl J, Dvorakova E (2007) Habitat management for the protected Maculinea butterflies: The effect of mowing. Cereal Research Communications 35: 857-860. doi: 10.1556/Crc.35.2007.2.173
  • Nowicki P, Pepkowska A, Kudlek J, Skorka P, Witek M, Settele J, Woyciechowski M (2007) From metapopulation theory to conservation recommendations: Lessons from spatial occurrence and abundance patterns of Maculinea butterflies. Biological Conservation 140: 119-129. doi: 10.1016/j.biocon.2007.08.001
  • Nowicki P, Witek M, Skorka P, Settele J, Woyciechowski M (2005) Population ecology of the endangered butterflies Maculinea teleius and M. nausithous and the implications for conservation. Population Ecology 47: 193-202. doi: 10.1007/s10144-005-0222-3
  • Rakosy L, Tartally A, Goia M, Mihali C, Varga Z (2010) The Dusky Large Blue Maculinea nausithous kijevensis (Sheljuzhko, 1928) in the Transylvanian basin: New data on taxonomy and ecology. Nota lepidopterologica 33: 31-37.
  • Settele J, Kühn E, Thomas JA (2005)Studies on the Ecology and Conservation of Butterflies in Europe, Vol. 2: Species Ecology along a European Gradient: Maculinea butterflies as a Model. Pensoft, Sofia-Moscow, 289 pp.
  • Stettmer C, Binzenhöfer B, Gros P, Hartmann P (2001a) Habitatmanagement und Schutzmaßnahmen für die Ameisenbläulinge Glaucopsyche teleius und Glaucopsyche nausithous. Teil 1: Populationsdynamik, Ausbreitungsverhalten und Biotopverbund. Natur und Landschaft 76: 278-287.
  • Stettmer C, Binzenhöfer B, Gros P, Hartmann P (2001b) Habitatmanagement und Schutzmaßnahmen für die Ameisenbläulinge Glaucopsyche teleius und Glaucopsyche nausithous. Teil 2: Habitatansprüche, Gefährdung und Pflege. Natur und Landschaft 76: 366-376.
  • Stettmer C, Bräu M, Binzenhöfer B, Reiser B, Settele J (2008) Pflegeempfehlungen für das Management der Ameisenbläulinge Maculinea teleius, Maculinea nausithous und Maculinea alcon. Ein Wegweiser für die Naturschutzpraxis. Natur und Landschaft 83: 480-487.
  • Tartally A, Rakosy L, Vizauer TC, Goia M, Varga Z (2008) Maculinea nausithous exploits Myrmica scabrinodis in Transylvania: Unusual host ant species of myrmecophilous butterfly in an isolated region (Lepidoptera: Lycaenidae; Hymenoptera: Formicidae). Sociobiology 51: 373-380.
  • Thomas JA (1984) The Behavior and Habitat Requirements of Maculinea nausithous (the Dusky Large Blue Butterfly) and Maculinea teleius (the Scarce Large Blue) in France. Biological Conservation 28: 325-347.
  • Witek M, Sliwinska EB, Skorka P, Nowicki P, Wantuch M, Vrabec V, Settele J, Woyciechowski M (2008) Host ant specificity of large blue butterflies Phengaris (Maculinea) (Lepidoptera: Lycaenidae) inhabiting humid grasslands in East-central Europe. European Journal of Entomology 105: 871-877.
  • Wynhoff I (1998) The recent distribution of the European Maculinea species. Journal of Insect Conservation 2: 15-27.
  • Wynhoff I, Grutters M, van Langevelde F (2008) Looking for the ants: selection of oviposition sites by two myrmecophilous butterfly species. Animal Biology 58: 371-388. doi: 10.1163/157075608x383683
  • Wynhoff I, van Gestel R, van Swaay C, van Langevelde F (2011) Not only the butterflies: managing ants on road verges to benefit Phengaris (Maculinea) butterflies. Journal of Insect Conservation 15: 189-206. doi: 10.1007/s10841-010-9337-8
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Occurs in one or two small areas of northwest Spain with the main distribution area being from central eastern France, Switzerland, Germany (absent from the north) and eastwards.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in damp habitats where the foodplant Great Burnet (Sanguisorba officinalis) is found.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phengaris nausithous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phengaris nausithous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Maculinea nausithous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Maculinea nausithous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGATTTGAGCAGGAATGCTAGGAATATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTTCAGGATCTTTAATTGGGAATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGCGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCGCGAATAAATAACATAAGATTTTGATTATTACCGCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCGCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCGGGAATTTCTTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATAAAAGTAAATAATTTATTTTTTGATCAAATATCATTATTTATTTGAGCGGTAGGTATTACAGCATTATTATTACTACTATCTTTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACAGATCGAAACCTAAATACTTCATTTTTTGACCCTGCTGGAGGTGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dusky Large Blue

The Dusky Large Blue (Phengaris nausithous) is a species of butterfly in the Lycaenidae family. It is found in Armenia, Austria, Azerbaijan, Belarus, Bulgaria, Czech Republic, France, Georgia, Germany, Hungary, Kazakhstan, Moldova, Montenegro, Poland, Romania, Russia, Serbia, Slovenia, Spain, Switzerland, and Ukraine.[1]

Life cycle of this species is strongly related to Sanguisorba officinalis (Great Burnet).[1]

References[edit]

  1. ^ a b World Conservation Monitoring Centre 1996. Maculinea nausithous. 2006 IUCN Red List of Threatened Species. Downloaded on 6 October 2010
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!