Overview

Brief Summary

North American Ecology (US and Canada)

Calycopis cecrops is resident to the southeastern United States and migratory in parts northward, occasionally as far as Michigan and Saskatchewan (Scott 1986). Habitats aremostly lower austral to upper austral zone brush and open dry woods. Host plants are shrubs and herbs from several families: Anacardiaceae, Myricaceae, Euphorbiaceae. Larvae are thought to eat mostly fallen detritus. Eggs are laid singly on dead leaves and detritus beneath the host plant. Individuals overwinter as early fourth-stage larvae. There are multiple flights each year with the approximate flight time April1-Oct31 in the northern part of the range and year-round in Florida (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Ohio and Long Island south to Texas and Florida. Most common on the coast of southeastern United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Forest and forest edges; hammocks, fields, right of ways, brushland, occasionally yards with foodplants.. Larval host plants include genera Rhus, Croton, and Myrica. Adults are seen mostly in the open and on edges in spring but are very commonly encountered in deep shade in forest in hot summer weather (observations by D. Schweitzer in New Jersey). Adults commonly visit gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults sip flower nectar and mud. Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calycopis cecrops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGCTAGGAACATCTTTAAGAATCTTAATTCGAATAGAATTAGGTACTCCCGGATCTCTAATTGGAGATGATCAAATTTATAACACAATTGTTACAGCACATGCTTTTATTATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATATTATTAGTATCAAGAAGAATAGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGGGCTTCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAGTTTCATCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGTGTTAATAATATAGCATTTGATCAAATATCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTATTATTATCTTTACCTGTATTAGCCGGAGCTATTACTATATTATTAACAGATCGAAACCTTAATACTTCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calycopis cecrops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread-adapted to disturbed habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-banded Hairstreak

Red-banded Hairstreak

The Red-banded Hairstreak (Calycopis cecrops) is a butterfly native to the southeastern United States. It feeds on fallen leaves of sumac species and other trees. Its size ranges from 0.9–1.25 inches (23–32 mm). It lives near coastal areas and edges.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!