Articles on this page are available in 3 other languages: French (2), Dutch (1), German (1) (learn more)

Overview

Brief Summary

Green hairstreeks live in heathlands. The caterpillars live off of heather bushes. The adult butterflies are very conspicuous in May with their very green wings. In the Netherlands, its distribution regions used to be limited to heather fields in the eastern part of the country. However since 1996, they have also settled on the Wadden Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

One generation is produced each year (3); adults emerge from mid-April onwards (2) and the flight period is concentrated between May and early June in southern parts of England. Further north, the flight period may occur a month later (2). Females lay eggs singly on the buds or young shoots of the foodplants, after about a week the eggs hatch, and the caterpillars begin to feed (3). At the end of July the caterpillars descend to the ground, where they pupate in the leaf litter (3). The pupae produce audible squeaks, which attract ants, and a pupa has been found in a nest of the ant Myrmica sabuleti. It is believed that the pupae are buried by ants, but the species involved in this relationship are not known (2). The pupal stage hibernates, and the adults emerge the following spring (3). This species is the only hairstreak butterfly that hibernates as a pupa; it is therefore the earliest of these butterflies to emerge (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The wings of the green hairstreak butterfly are dull brown on the uppersides, but bright green on the underside (1), with a white 'streak' across the fore- and hindwings (3). The sexes are very similar in appearance, but males can be distinguished by the presence of a small pale spot on each forewing (1). The plump caterpillar grows to 1.5 cm in length, and is flattened at each end. It is green in colour, with a brown head, has a dark line passing along the back and rows of diagonal yellowish-white markings (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

This butterfly has a wide distribution in Scotland and Wales. It is also found on the Inner Hebrides and Arran (2). In England it is widespread in the north on moorlands, and on calcareous grasslands of the south. It has declined in eastern areas where these habitats are absent (2). Elsewhere the species is widespread in Ireland, and occurs throughout Europe and some parts of North Africa, extending through Asia to Siberia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in a wide range of habitats including calcareous grasslands, moorland, heathland, woodland clearings and rides, bogs, disused quarries and railway cuttings. It requires the presence of the foodplants of the caterpillars; on calcareous grasslands these are common rock rose (Helianthemum nummularium) and common bird's-foot-trefoil (Lotus corniculatus); on heathland gorse Ulex europeaus), broom (Cytisus scoparius) and dyer's greenwood (Genista tinctoria) are used, whilst bilberry (Vaccinium myrtillus) is used on moorland. A range of other foodplants is also occasionally utilised (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
larva of Cadurciella tritaeniata is endoparasitoid of larva of Callophrys rubi
Other: sole host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Callophrys rubi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 77
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Callophrys rubi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATATTAGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTATCATCTAATATTGCACATGGAGGATCATCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGGATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCATTATTTATTTGATCTGTAGGTATTACAGCATTATTATTATTATTATCATTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

This species is not threatened, and is not listed under any conservation designations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Despite being a widespread species at present, the green hairstreak has been lost in some areas as a result of habitat loss, changes in management, and neglect of sites (2). In upland areas, overgrazing is a threat, and in woodlands, over-shading has increased as a result of a decline in traditional woodland management techniques (2). Other potential threats include drainage and peat extraction in lowland areas, and tree-planting in the uplands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Relatively little is known of this butterfly, and it is likely that it has been under-recorded in some areas; both research and monitoring are therefore required to gain insights into this species (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green Hairstreak

The Green Hairstreak, Callophrys rubi, is a small butterfly in the family Lycaenidae.

Etymology[edit]

The genus name Callophrys is a Greek word meaning "beautiful eyebrows", while the species Latin name rubi derives from Rubus (bramble), one of the hostplants.[1]

Subspecies[edit]

Description[edit]

Callophrys rubi has a wingspan reaching about 26–30 millimetres (1.0–1.2 in).[3] The upperside of the wings is a uniform dull brown with two paler patches on the male's forewings made up of scent scales.[1] The undersides are a bright green with a thin white line, often reduced to a faint row of dots or even missing altogether. The iridescent green colour of the undersides is a structural colour caused by diffraction and interference of light by microscopic repeating structures in the wing scales.[4] The caterpillars are green with yellow markings along the back.[1] Like other members of the family they are rather sluglike.

Life cycle and behaviour[edit]

Egg
Plate from Eckstein Die Schmetterlinge Deutschlands depicting the larva, pupa and imago Fig.3

These butterflies can be found already at the end of March, the flight time usually extend until the end of June, but sometime they were seen in July and early August.[3] They never rest with their wings open, in order to keep its green camouflage.[1][5] The males show a territorial behavior.[1]

The eggs are laid singly.[1] The caterpillars are not known to be tended by ants like some lycid larvae but the pupae, which are formed at ground level, emit squeaks which attract ants and it is thought that ants will always bury any that are found. Green Hairstreaks overwinter as pupae and are univoltine, having one generation of adult butterflies per year.

The larva is recorded as feeding on Vaccinium myrtillus, Vaccinum uliginosum, Betula, Rubus idaeus, Vicia cracca, Trifolium medium, Calluna vulgaris, Frangula, Rhamnus, Ribes, Spiraea, Caragana, Chamaecytisus, Hedysarum, Genista, Trifolium and Hippophae rhamnoides in different parts of its range.[2]

This polyphagous species has what is probably one of the largest range of foodplants of any British butterfly. Early butterfly collectors thought that the only foodplant was Bramble (blackberry) Rubus fruticosus but as its habits became better understood the list grew and will probably continue to do so. Depending on the habitat it will use Common Rock Rose Helianthemum nummularium, Bird's-foot trefoil Lotus corniculatus, Gorse Ulex europaeus, Broom Cytisus scoparius, Dyer's Greenweed Genista tinctoria, Bilberry Vaccinium myrtillus, Dogwood Cornus sanguinea, Buckthorn Rhamnus cathartica, Cross-leaved Heath Erica tetralix and Bramble.[1]

Habitat[edit]

Mediterranean habitat of Callophrys rubi (surroundings of Genova, at abt. 100 m. a.s.l.)

The wide range of foodplants means that this butterfly is able to use a wide range of habitats including chalk downland, heathland, moorland and clearings in woodland.[1] It is present in wetlands as well as on poor dry meadows, at an elevation of about 0–2,300 metres (0–7,500 ft).[3][5]

Distribution[edit]

Callophrys rubi is found in most of Europe,[6] North Africa, Russia, Asia Minor, Siberia, Amurland, Baluchistan and Chitral.[2] It is still widespread across most of the UK, although many colonies have been lost in recent years. In Mediterranean countries it is quite localised and it is usually found near the coasts.

References[edit]

  1. ^ a b c d e f g h Learn About Butterflies
  2. ^ a b c Funet
  3. ^ a b c Butterfly Guide
  4. ^ Morris R.B. (1975) Iridescence from diffraction structures in the wing scales of Callophrys rubi, the Green Hairstreak. Journal of Entomology (A) 49, 149-154.
  5. ^ a b Eurobutterflies
  6. ^ Fauna europaea

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!