Overview

Brief Summary

North American Ecology (US and Canada)

Resident throughout much of central and eastern North America (Scott 1986). Habitats are wooded areas. Host plants can be herbs, vines, shrubs or trees, with known hosts in many families. Eggs are laid on the host plant flower buds singly. Larvae are tended by ants. Individuals overwinter as pupae. There are one or two flights each year depending on location. Flights occur between Feb 1 and Nov 30 in the more southern parts of the range, and often between May 15-Aug 15 in the most northern regions (Scott 1986). Treated as a subspecies of C. argiolus by some (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) If the New England Azure is included, the range is approximately Massachusetts west through southern New York, extreme southern Ontario, southern Michigan, and presumably to Wisconisn or Minnesota south certainly to Arkansas and presumably into Texas and definitely Georgia, probably also the Florida panhandle. This species is absent from much of the coastal plain including the core of the New Jersey Pine Barrens, and from some higher ridgetops and probably the colder parts of the Poconos. This is the common spring azure of mainly deciduous forests of the Piedmont, inner coastal plain, lower elevations in the southeastern mountains, and most of the Midwest. Inclusion of populations in New England to northwest New Jersey is tentative. See Taxonomy Comments. No western populations appear to be conspecific based on their appearance and scale morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Argus pseudargiolus Boisduval & Le Conte, 1833
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Locality: Amer. septentr.. Date:Unknown, United States
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: This is mostly a forest butterfly that is typically seen along paths or on flowering shrubs often well into the woods.. In most of the range any sort of deciduous or mixed deciduous-pine forest with the locally utilized foodplants in the understory or subcanopy is habitat. Adults may occur along edges, but they do not venture more than a few meters into fields or open habitats and they are rarely seen in yards or gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: The primary larval foodplant is usually flowering dogwood (Cornus florida), but species of Viburnum are also very widely used. In southern New Jersey American holly (IIlex opaca) is apparently a significant foodplant, although this azure is not often found there in the absence of dogwood. Populations from northwestern New Jersey, southeastern New York, Connecticut, Rhode Island, and Massachusetts that are tentatively included in this species feed on highbush blueberry (Vaccinium corymbosum) and Viburnum spp., apparently both if they are available, and less often on Prunus serotina flowers. With all foodplants, larvae feed mostly on the flowers.


Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults have many food sources including sipping nectar, mud, dung. Males both perch and patrol for females (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: There is always only one brood in spring, mostly in April or early May in much of the range. Where they overlap. C. ladon starts later than C. lucia (sometimes more than a month later in southern New Jersey), about the same time as C. idella, and earlier than C. serotina. However any of these that are locally sympatric will definitely overlap in phenology. The larval stage takes about a month, and except in the northeast corner of the range, most or all larvae probably complete feeding in May or very early June. All populations have one generation annually and spend most of the year as pupae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Celastrina ladon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATCTTCGGAATTTGAGCAGGTATATTAGGAACATCATTAAGAATCTTAATTCGTATAGAATTAGGAACACCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTGATATTATTGATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCATCTAATATTGCACATAGTGGATCATCTGTAGATCTAGCAATTTTCTCATTACATTTGGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATCTGAGCAGTAGGAATTACAGCACTATTACTTCTTCTTTCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Celastrina ladon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: While this is the common spring azure in much of the eastern United States, between dogwood (Cornus florida) mortality due to an exotic fungus, and loss of flowering viburnums to deer, this species is already declining in some parts of its range (David Wright), although it is not of immediate concern except locally in places with both high dogwood mortality and severe browsing of Viburnum by deer. For now this azure appears to be persisting where at least one of these plants remains common and reliably flowering, or in places where alternate foodplants, like holly, are used. Persistence depends on flowering foodplants every year, not just in most years. Given impacts from deer and the dogwood fungus, this butterfly really cannot be considered "demonstrably" secure in a substantial part of its range, but is is "apparently" globally secure. Ironically it might be most secure in the few places (e.g. southern New Jersey) where American holly is a foodplant since deer do not impact this tree. This azure should be monitored in places where the foodplants are being lost to fungus or their flower production is curtailed by deer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: The loss or reduction of a major foodplant, healthy flowering dogwood (Cornus florida), to an exotic fungus is a threat to this species in some parts of the range and may become so in most of the range. This threat is compounded now in many places where deer have greatly reduced or eliminated the usual alternate foodplants, viburnum flowers (although not necessarily actually killed the plants). As far as known Celastrina ladon should persist where one of the foodplants remains common and flowers successfully every year. This butterfly is declining substantially in the Appalachians (David Wright) and may become extirpated from some counties. It is not presently threatened in most of its range but the dogwood blight could spread. Ironically this azure is apparently stable along Delaware Bay and on the Cape May peninsula in southern New Jersey, one of few areas in its range where it was historically uncommon and local. American holly, which deer do not normally eat, is an important alternate foodplant (along with dogwood) there. Other than dogwood blight fungus and excessive deer browsing, there are no known large-scale threats, although invasive shrubs and vines might also be impacting foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Celastrina ladon

The Spring Azure (Celastrina ladon) is a butterfly of the Lycaenidae family. It is found in North America from Alaska and Canada south of the tundra, through most of the United States except the Texas coast, southern plain and peninsula Florida; south in the mountains to Colombia.

Since the publication of a monograph on the Lycaenopsis Group of Lycaenid genera in 1983 by Eliot & Kawazoe,[2] ladon has been considered by some taxonomic authorities to be a subspecies of Celastrina argiolus (Linnaeus, 1758). Other authorities still consider C. ladon and related species C. neglecta and C. serotina, to be "full" species.[3][4][5][6][7]

Similar Species[edit]

References[edit]

  1. ^ Entomology Collection, E.H. Strickland Entomological Museum
  2. ^ Eliot, J. N. and Kawazoe, A., 1983. Blue butterflies of the Lycaenopsis group: 1-309, 6 pls. London.
  3. ^ Cherry Gall Azure full species status, BugGuide.com
  4. ^ Spring Azure, Butterflies of Canada
  5. ^ Spring Azure, Butterflies and Moths of North America
  6. ^ Spring Azure, Encyclopedia of Life
  7. ^ Celastrina, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Until the 1980s or even by some books into the 2000s this name included several other species such as C. neglecta, C. neglectamajor, C. humulus, C. idella, C. lucia, C. echo etc. See Wright and Pavulaan (1999) for review of the nomenclature. The names pseudargiolus and violacea are synonyms of ladon. Further details by David Wright are in preparation. This is the familiar spring azure of most of the eastern United States except most of the Atlantic coastal plain, and along the Canadian border. Compared to most azures, C. ladon is well understood and uniform in appearance (except in New England see below), biology, and primary foodplant (flowering dogwood) over most of its range. Most populations of C. ladon occur as forms "violacea", many with "marginata" also common and the form "lucia" is usually completely absent or much less than 1% except at the extreme northeast. The male has the by now well-known "unique" scale morphology (see Wright and Pavulaan, 1999) and lacks androconia and is thus easily identified microscopically from spread specimens. This scale trait is almost completely diagnostic except that it also occurs in C. ebenina. Various western taxa (Opler and Warren, 2002) traditionally included in ladon do not share the unique scale morphology or otherwise resemble ladon and there is almost no chance any of them are conspecific with C. ladon. No subspecies of true C. ladon are recognized or anticipated in the future despite the names used in some popular quides, which if followed would place three or four "subspecies" sipping from the same patches of wet sand at the same time in New Jersey and elsewhere. C. ladon is not monophagous on dogwood (Cornus florida) and often uses Viburnum spp. and less often Ilex opaca. Taxonomic recognition is not warranted for such local foodplant strains.

The most common spring azure in northwestern New Jersey through Connecticut, Rhode Island and much of Massachusetts (see Klots,1951 PL 21: 6 and ?7) is an enigma. It has the male wing scales of C. ladon and C. ebenina but looks more like C. lucia and shares foodplants with both.. The "violacaea" form is at best rare, and the "lucia" patched form occurs at a non-trivial frequency with most individuals being of the "marginata" form. According to David Wright these azures are similar to C. lucia in allozymes, but this is not published and needs to be evaluated. Highbush blueberry (Vaccinium corymbosum) is the most commonly used foodplant, but oviposition has been observed (and the voucher collected) on Prunus serotina flowers near Boston. Viburnum spp. are used range-wide and apparently become the primary foodplant at the western end of the range in New Jersey. Viburnum species are also major foodplants for C. ladon. These southern New England azures are not known to use flowering dogwood (Cornus florida), the primary foodplant of C. ladon in much of its range, even in Connecticut where this tree was common well into the 1980s and still occurs. However, it is not known whether the larvae could mature on dogwood and it is possible they do use it. In New Jersey these "New England Azures" occur commonly in the relatively cold northwest of the state south into parts of Warren County. On the Piedmont of adjacent counties to the east and south normal C. ladon is the only member of this group. The "marginata" form occurs in both entities and individuals of this form are apparently inseparable by any characters. Normal New Jersey Piedmont C. ladon occurs more commonly as form "violacea" but there seems to be no other difference. D. Wright has informed Schweitzer that the relative frequencies of these forms can vary substantially from year to year in adjacent eastern Pennsylvania. Possibly the dark forms are induced by cold in C. ladon. At any rate a major shift in the frequency of the color forms alone, even assuming this is at least in part genetically based, does not justify treating these southern New England Azures as a separate species from C. ladon with which they share obviously derived scale morphology. It should be noted that otherwise C. ladon is not known to use blueberry, the main foodplant of more southern populations of C. lucia, as a foodplant anywhere. Schweitzer has sleeved two South Jersey C. ladon on V. corymbosum and obtained no eggs. C. lucia always oviposit freely on the same bushes. This difference does suggest some genetic differentiation. For now these northeastern populations seem best treated as a northeastern variant of C. ladon, with which they share a foodplant and from which "marginata" form specimens apparently cannot be separated. Alternate explanations are that that this entity is an intergrade between C. lucia and C. ladon, probably a relict of hybridization during the Pleistocene since these species remain separate in their modern contact areas; or that the Southern New England Azure is a fully separate species. The difficulty with the former explanation is that that rarely or never hybridize now. This summary by Dale Schweitzer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!