You are viewing this Genus as classified by:

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Ecology

Habitat

Depth range based on 558 specimens in 13 taxa.
Water temperature and chemistry ranges based on 367 samples.

Environmental ranges
  Depth range (m): 60 - 25000
  Temperature range (°C): 2.523 - 19.650
  Nitrate (umol/L): 0.577 - 35.686
  Salinity (PPS): 33.963 - 36.604
  Oxygen (ml/l): 1.249 - 5.911
  Phosphate (umol/l): 0.120 - 2.602
  Silicate (umol/l): 1.641 - 69.977

Graphical representation

Depth range (m): 60 - 25000

Temperature range (°C): 2.523 - 19.650

Nitrate (umol/L): 0.577 - 35.686

Salinity (PPS): 33.963 - 36.604

Oxygen (ml/l): 1.249 - 5.911

Phosphate (umol/l): 0.120 - 2.602

Silicate (umol/l): 1.641 - 69.977
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaunax sp. (var Q1)

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax cf. breviradius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. E

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. W3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. W1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. f

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. e

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. d

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. b

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. a

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. C

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax sp. A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chaunax cf. flammeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTAGTTTTTGGCGCCTGAGCTGGAATAGTCGGCACAGCTTTAAGCCTACTTATTCGAGCCGAACTAAGCCAGCCGGGCTCACTTTTAGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATCTTCTTCATAGTAATACCAGTCATGATCGGGGGGTTCGGAAATTGACTTATCCCCCTAATGATTGGGGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTCCCCCCCTCTTTCCTTCTCCTACTCGCTTCCTCCGGGGTTGAGGCCGGGGCGGGTACCGGGTGAACCGTCTACCCTCCGCTAGCAGGGAACCTGGCCCATGCAGGAGCATCTGTTGACTTAACAATCTTTTCTCTTCATCTAGCAGGAGTCTCATCAATTCTTGGAGCTATCAACTTTATTACAACAATTATTAATATAAAACCCCCAGCTATCTCGCAATATCAGACCCCCCTCTTCGTATGGGCCGTTTTAATTACCGCTGTTCTTCTTTTGCTTTCCCTACCTGTACTTGCTGCCGGCATCACCATGCTTCTCACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGAGGGGACCCAATTCTCTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaunax cf. flammeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:105Public Records:15
Specimens with Sequences:96Public Species:5
Specimens with Barcodes:93Public BINs:5
Species:23         
Species With Barcodes:22         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Chaunax

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chaunax

Chaunax is a genus of bony fish in the sea toad family, Chaunacidae.[1] They are found in tropical and subtropical oceans around the world, and most species are found a depths between 180 and 1,100 m (590 and 3,600 ft), but C. endeavouri occurs as shallow as 50 m (160 ft) and C. fimbriatus as deep as 1,985 m (6,512 ft).[2][3] Depending on the exact species involved, they reach a total length of 11–40 cm (4.3–16 in).[4]

Species

There are currently 13 recognized species in this genus:[4][5]

References

  1. ^ William J. Richards (2005). Early Stages of Atlantic Fishes: An Identification Guide for the Western Central North Atlantic. CRC Press. ISBN 978-0-8493-1916-7.
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). "Chaunax endeavouri" in FishBase. July 2012 version.
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). "Chaunax fimbriatus" in FishBase. July 2012 version.
  4. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2013). Species of Chaunax in FishBase. February 2013 version.
  5. ^ a b c d e Ho, H.-C., Roberts, C.D. & Stewart, A.L. (2013): A review of the anglerfish genus Chaunax (Lophiiformes: Chaunacidae) from New Zealand and adjacent waters, with descriptions of four new species. Zootaxa, 3620 (1): 89–111.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!