Overview

Brief Summary

Biology

The flight period of this butterfly is variable, but usually occurs between early June and mid-August (3). This species has one brood a year; eggs are laid singly on the upper surface of leaves of the foodplant, and hatch after a week (2). The caterpillars hibernate at the bottom of the food plant or on the ground (3), and complete their development the following spring (2). Recent genetic studies have shown that single-brooded populations once thought to be northern brown argus occurring in the Peak District, Yorkshire Wolds and north Wales are actually brown argus (Aricia agestis). Populations in Co. Durham once thought to be Durham argus (A. a. salmacis) are actually mainly A. a. artaxerxes (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This small butterfly is dark brown in colour with orange crescents towards the edge of the wings, those on the forewings are absent or very small, and the underside is pale (1). In Britain there is a noticeable white spot in the centre of the upperside of both forewings (1). The caterpillar measures up to 1.3 centimetres in length, and has a green body with a darker green line along the sides (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Found in Scandinavia, mountainous parts of central Europe and North Africa. A. a. artaxerxes is found in Scotland and possibly northern England, and A. a. salmacis is found in Co. Durham (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Inhabits sheltered areas of free draining unimproved grasslands with patches of bare ground, supporting the main caterpillar foodplant common rock-rose, Helianthemum nummularium (3). Preferably there should be light grazing on the site (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aricia artaxerxes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTTTTCTACAAATCATAAAGATATTGGAACATTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGTATGGAATTAAGAATTCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTGGGAGCACCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTCTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGAGTAAATAATTTATCATTTGACCAAATATCATTATTTATTTGAGCAGTAGGTATTACCGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATATTAATACCTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aricia artaxerxes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 63
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

In the UK this species is classified as Nationally Scarce and protected under Schedule 5 of the Wildlife and Countryside Act 1981, with respect to sale only (4). It has two subspecies; Aricia artaxerxes artaxerxes and Aricia artaxerxes salmacis (the Durham argus or Castle Eden argus).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

There has been a serious decline in this species around the Durham area, and reductions have also occurred in southern Scotland. More surveys are needed to ascertain the species' status in this area, however (3). Sheltered unimproved grassland with low grazing levels has been greatly reduced, and persists in fragmented patches. Loss and degradation of this habitat has greatly contributed to the decline of this species. In some cases inappropriate grazing regimes result in otherwise suitable habitat becoming degraded (4); a lack of grazing results in scrub invasion, and overgrazing excludes the species even if the food plant is abundant (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Many colonies in the north of England occur in nature reserves where management has successfully been altered for this species. A good example occurred at St Abb's Head National Nature Reserve, where in 1992 there was a switch from heavy grazing to selective spring and autumn grazing. The population of the northern brown argus subsequently increased dramatically (3). The Countryside Stewardship Scheme includes management prescriptions aimed at this species; private landowners receive grants for managing their land in these ways (3). The northern brown argus is a priority species under the UK Biodiversity Action Plan (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Brown Argus

The Northern Brown Argus (Aricia artaxerxes) is a butterfly in the family Lycaenidae.It is found throughout much of the Palearctic ecozone.

Contents

Subspecies

  • A. a. allous (Geyer, [1836]) Alps, North Europe
  • A. a. vancalica Kaaber & Hoegh-Guldberg, 1961 West Europe
  • A. a. ukrainica (Obraztsov, 1936) South-East Europe
  • A. a. inhonora Jachontov, 1909 "Rossia [Russia]centrali et orientali"
  • A. a. sheljuzhkoi (Obraztsov, 1935) Caucasus Major
  • A. a. turgaica (Obraztsov, 1935) South West Siberia
  • A. a. lepsinskana (Obraztsov, 1935) Dzhungarsky Alatau
  • A. a. transalaica (Obratzov, 1935)Ghissar, Darvaz, Pamirs-Alai, Himalayas
  • A. a. scytissa Nekrutenko, 1985 Tian-Shan
  • A. a. sarmatis (Grum-Grshimailo, 1890) S.Urals
  • A. a. strandi (Obraztsov, 1935) Altai – West Amur
  • A. a. mandzhuriana (Obraztsov, 1935) East Amur, Ussuri
  • A. a. hakutozana (Matsumura, 1927) North Korea
  • A. a. sachalinensis (Matsumura, 1919) Sakhalin

Appearance, behaviour and distribution (Great Britain)

Aricia artaxerxes in northern England showing underwing pattern

This species has confused British entomologists for years. Since its discovery in Britain it has been thought to be a form or a subspecies of the Brown Argus Aricia agestis and as well as a species in its own right. Since 1967 all Brown Argus in the north of England and Scotland have been classified as this species. In the last few years genetic studies have shown that some of the colonies along the border of the two species ranges are still being wrongly classified and some colonies in the north of England are now thought to be A. agestis. So far as is known their ranges do not overlap in the UK. The Scottish form is visually quite distinct from the Brown Argus. It usually has a small white dot in the centre of the upper side fore wing and the black spots on the underside are missing leaving larger white spots on the light brown background. The northern English populations belong to a form called salmacis and are very similar to the Brown Argus including the presence of black spots on the under-wing (see photo) hence all the confusion. In Europe where it is known as the Mountain Argus, it is widespread in Scandinavia and mountainous regions of central, southern and Eastern Europe. The species is considered locally rare in Britain, and the UK has established a detailed Biodiversity Action Plan to conserve this species along with a small number of other butterfly species.

Life cycle and food plants

Note that information on this species applies to Great Britain and some details may not be consistent with the species in other parts of its range.

Eggs are laid singly on the upperside of the food plant leaves. As far is known Common Rock-rose Helianthemum nummularium seems to be the sole food plant in Britain. The larvae hibernate while still quite small and continue to feed and grow the following spring. Like the Brown Argus, it is attractive to ants and often attended by them. Pupation takes place at ground level in late May and butterflies are on the wing from mid June to mid July.

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!