Ecology

Associations

In Great Britain and/or Ireland:
Foodplant / open feeder
larva (later) of Aricia agestis grazes on live leaf of Helianthemum
Remarks: season: summer & autumn-spring

Foodplant / open feeder
larva (later) of Aricia agestis grazes on live leaf of Geranium molle

Foodplant / open feeder
larva (later) of Aricia agestis grazes on live leaf of Erodium cicutarium agg.
Remarks: Other: uncertain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aricia agestis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 66 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTTTTCTACAAATCATAAAGATATTGGAACATTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGTATGGAATTAAGAATTCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTGGGAGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTCTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGAGTAAATAATTTATCATTTGACCAAATATCATTATTTATTTGAGCAGTAGGTATTACCGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGGGCAATTACTATATTATTAACTGATCGAAATATTAATACCTCATTTTTTGATCCTGCTGGAGGAGGAGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aricia agestis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 114
Specimens with Barcodes: 156
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown Argus

The Brown Argus (Aricia agestis) is a butterfly in the family Lycaenidae. It is found throughout the Palearctic ecozone North to northern Jutland (Denmark) and East to Siberia and Tian Shan.

Subspecies[edit]

  • A. a. agestis S. Europe, Central Europe
  • A. a. calida Chavigneire Sicily, Italy, Asia Minor
  • A. a. azerbaidzhana Obraztsov, 1935 Transcaucasia, Caucaus Major
  • A. a. nazira (Moore, 1865) Darvaz, W.Pamirs, N. W. Himalayas

Appearance,biology (Great Britain)[edit]

Lycaenidae - Aricia agestis.JPG

Note that information on this species applies to Great Britain and some details may not be consistent with the species in other parts of its range.

Although one of the "Blues" both sexes are brown on the uppersides with a band of orange spots at the border of each wing. They can be mistaken for other female blues but the Brown Argus never has any blue scales at the base of the wings like other female Blues often do. It could also be mistaken for the Northern Brown Argus Aricia artaxrexes were it not for the fact that their ranges do not overlap in the UK, unlike on continental Europe. The underside has the typical "blue" pattern of a greyish/brownish ground colour with black spots outlined in white and a row of orange spots along the border. The pattern of the black spots is the best way to distinguish this species from female Common, Chalk Hill and Adonis Blues as they lack the black spot found near the base of the forewing which is present on these three species. This species has seen an expansion in its range in recent years and is widely distributed across southeast England and most of the Midlands with colonies occurring in Wales and as far north as Yorkshire. These northern sites have seen a lot of confusion in recent years with genetic studies looking at various colonies to separate the two Aricia spp. Until a few years ago, these northern colonies were thought to be the Northern Brown Argus and more colonies may yet be found to be misidentified. Like other blues it is common on the chalk downlands of southern England but will also use other habitats such as woodland clearings, coastal grasslands and heathland. It is completely unrelated to the Scotch Argus.

Life cycle and food plants[edit]

Note that information on this species applies to Great Britain and some details may not be consistent with the species in other parts of its range. Common Rock-rose Helianthemum nummularium is the favoured foodplant on Calcareous soils. In other habitats Dove's-foot Cranesbill Geranium molle and Common Stork's-bill Erodium cicutarium are used and possibly other Geranium spp. as well. Eggs are laid singly on the underside of leaves. The typically slug-like lycid larvae are green with a pale line along each side and always attended by ants. They hibernate as fully grown larvae and pupate the following spring. There are two broods a year in the southern colonies with adults on the wing in May and June and again in late July till mid September but further north they are single brooded and fly in June and July.

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!