Ecology

Habitat

Depth range based on 125 specimens in 17 taxa.
Water temperature and chemistry ranges based on 97 samples.

Environmental ranges
  Depth range (m): 2 - 402.5
  Temperature range (°C): 14.262 - 28.122
  Nitrate (umol/L): 0.046 - 12.178
  Salinity (PPS): 34.379 - 35.652
  Oxygen (ml/l): 4.121 - 4.833
  Phosphate (umol/l): 0.100 - 0.897
  Silicate (umol/l): 0.869 - 6.052

Graphical representation

Depth range (m): 2 - 402.5

Temperature range (°C): 14.262 - 28.122

Nitrate (umol/L): 0.046 - 12.178

Salinity (PPS): 34.379 - 35.652

Oxygen (ml/l): 4.121 - 4.833

Phosphate (umol/l): 0.100 - 0.897

Silicate (umol/l): 0.869 - 6.052
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:20
Specimens with Sequences:17
Specimens with Barcodes:17
Species:14
Species With Barcodes:13
Public Records:17
Public Species:13
Public BINs:9
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Halgerda cf. willeyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGACTCCTAGGAACAGGACTTAGCTTATTAATTCTATTTGAATTAGGAACAGCGGGTGCTTTTCTTGGTGAT---GACCATTTTTATAATGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATGGTAATACCGCTGATAATTGGAGGTTTTGGAAACTGAATGGTACCATTACTAATTGGAGCACCAGACATAAGATTTCCCCGTATAAATAACATAAGTTTCTGATTACTGCCACCATCTTTTATCCTCTTACTATGTTCAACTTTAATAGAAGGAGGAGCCGGAACAGGATGAACTGTCTATCCACCATTATCCGGACCAGTCGCTCATGGAGGTACCTCTGTAGATCTAGCTATTTTTTCCTTGCACCTAGCAGGAGCTTCCTCACTACTTGGTGCAATTAATTTTATTACTACAATTTTCAATATACGATCCTCAGCTATATCCATAGAACGAGTGAGGTTGTTTGTCTGATCAGTATTAGTAACAGCCTTCTTACTTCTTCTTTCTCTCCCGGTTCTTGCAGGAGCAATTACTATACTATTAACTGATCGAAATTTTAACACTAGATTTTTTGATCCAGCCGGAGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda cf. willeyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda

Halgerda is a genus of sea slugs, dorid nudibranchs, shell-less marine gastropod mollusks in the family Discodorididae.

Taxonomy[edit]

The genus Halgerda was classified within the family Halgerdidae by Odhner (1934).[2] Halgerdidae Odhner, 1926, is treated as a synonym of Discodorididae in the taxonomy of Bouchet & Rocroi (2005).[3] See also Valdés (2002).[4] Seven species of Halgerda were described in the years 1880-1905, two species in 1932-1949, four species from 1975-1982, then 22 species in the years 1993-2001. A number of undescribed species are known and many species show considerable variation across their ranges, which may indicate that more cryptic species exist.[5]

Distribution[edit]

All species of Halgerda are confined to the Indo-West Pacific Tropical region apart from two species which are found in warm temperate waters of South Africa and Southern Australia and one species from warm temperate Japanese waters.

Species[edit]

Species within the genus Halgerda include:[6]

References[edit]

  1. ^ Bergh, L.S.R. 1880. Beiträge zur Kenntniss der japanischen Nudibranchien. I. Verhandlungen der königlich-kaiserlich Zoologisch-botanischen Gesellschaft in Wien (Abhandlungen) 30:155-200, pls. 1-5, pages 191-5.
  2. ^ Odhner N. H. (1934). "The Nudibranchiata, British Antarctic ("Terra Nova") Expedition, 1910". Natural History Report, Zoology 7(5): 229-310.
  3. ^ Bouchet P., Rocroi J.-P., Frýda J., Hausdorf B., Ponder W., Valdés Á. & Warén A. (2005). "Classification and nomenclator of gastropod families". Malacologia: International Journal of Malacology (Hackenheim, Germany: ConchBooks) 47 (1-2): 1–397. ISBN 3925919724. ISSN 0076-2997. 
  4. ^ Valdés A. (2002). "A phylogenetic analysis and systematic revision of the cryptobranch dorids (Mollusca, Nudibranchia, Anthobranchia)". Zoological Journal of the Linnean Society 136: 535-636. doi:10.1046/j.1096-3642.2002.00039.x.
  5. ^ Gosliner, T.M., Behrens,D.W. & Valdes,A., 2008. Indo-Pacific Nudibranchs and Sea Slugs. A field guide to the World's most diverse fauna. Sea Challengers Natural History Books & The California Academy of Sciences. ISBN 978-0-9700574-3-3 426pp size: 21.5 x 28 cm
  6. ^ Bouchet, P.; Gofas, S. (2014). Halgerda Bergh, 1880. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=205320 on 2015-01-25
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!