Ecology

Habitat

Depth range based on 125 specimens in 17 taxa.
Water temperature and chemistry ranges based on 97 samples.

Environmental ranges
  Depth range (m): 2 - 402.5
  Temperature range (°C): 14.262 - 28.122
  Nitrate (umol/L): 0.046 - 12.178
  Salinity (PPS): 34.379 - 35.652
  Oxygen (ml/l): 4.121 - 4.833
  Phosphate (umol/l): 0.100 - 0.897
  Silicate (umol/l): 0.869 - 6.052

Graphical representation

Depth range (m): 2 - 402.5

Temperature range (°C): 14.262 - 28.122

Nitrate (umol/L): 0.046 - 12.178

Salinity (PPS): 34.379 - 35.652

Oxygen (ml/l): 4.121 - 4.833

Phosphate (umol/l): 0.100 - 0.897

Silicate (umol/l): 0.869 - 6.052
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda cf. willeyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGACTCCTAGGAACAGGACTTAGCTTATTAATTCTATTTGAATTAGGAACAGCGGGTGCTTTTCTTGGTGAT---GACCATTTTTATAATGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATGGTAATACCGCTGATAATTGGAGGTTTTGGAAACTGAATGGTACCATTACTAATTGGAGCACCAGACATAAGATTTCCCCGTATAAATAACATAAGTTTCTGATTACTGCCACCATCTTTTATCCTCTTACTATGTTCAACTTTAATAGAAGGAGGAGCCGGAACAGGATGAACTGTCTATCCACCATTATCCGGACCAGTCGCTCATGGAGGTACCTCTGTAGATCTAGCTATTTTTTCCTTGCACCTAGCAGGAGCTTCCTCACTACTTGGTGCAATTAATTTTATTACTACAATTTTCAATATACGATCCTCAGCTATATCCATAGAACGAGTGAGGTTGTTTGTCTGATCAGTATTAGTAACAGCCTTCTTACTTCTTCTTTCTCTCCCGGTTCTTGCAGGAGCAATTACTATACTATTAACTGATCGAAATTTTAACACTAGATTTTTTGATCCAGCCGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda cf. willeyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:20Public Records:17
Specimens with Sequences:17Public Species:13
Specimens with Barcodes:17Public BINs:9
Species:14         
Species With Barcodes:13         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Halgerda

Halgerda is a genus of sea slugs, dorid nudibranchs, shell-less marine gastropod mollusks in the family Discodorididae.

Taxonomy[edit]

The genus Halgerda has been classified within the family Halgerdidae by Odhner (1934).[2]

Halgerda is type species of the Halgerdinae Odhner, 1926, which is a synonym of Discodorididae in the taxonomy of Bouchet & Rocroi (2005).[3] See also Valdés (2002).[4]

Unfortunatelly Halgerda is classified in the family Dorididae at Sea Slug Forum (species of Dorididae and Discodorididae are classified within one family there),[5] that is inconsistent with references above.

Species[edit]

Species within the genus Halgerda include:[6]

References[edit]

  1. ^ Bergh R. (1881). [sep. 1880] Verh. zool.-bot. Ges. Wien 30(1880), Abh., 190.
  2. ^ Odhner N. H. (1934). "The Nudibranchiata, British Antarctic ("Terra Nova") Expedition, 1910". Natural History Report, Zoology 7(5): 229-310.
  3. ^ Bouchet P., Rocroi J.-P., Frýda J., Hausdorf B., Ponder W., Valdés Á. & Warén A. (2005). "Classification and nomenclator of gastropod families". Malacologia: International Journal of Malacology (Hackenheim, Germany: ConchBooks) 47 (1-2): 1–397. ISBN 3925919724. ISSN 0076-2997. 
  4. ^ Valdés A. (2002). "A phylogenetic analysis and systematic revision of the cryptobranch dorids (Mollusca, Nudibranchia, Anthobranchia)". Zoological Journal of the Linnean Society 136: 535-636. doi:10.1046/j.1096-3642.2002.00039.x.
  5. ^ "Species List". The Sea Slug Forum, accessed 17 December 2010.
  6. ^ WoRMS : Halgerda
  7. ^ a b c Fahey, Shireen J. and Gosliner, Terrence M (1999). "Description of three new species of Halgerda from the Western Indian Ocean with a redescription of Halgerda formosa, Bergh 1880.". Proceedings of the California Academy of Sciences 51 (8): 365–383. 
  8. ^ a b c d e f g h SeaSlugForum : Halgerda
  9. ^ Seaslug Forum : Halgerda carlsoni
  10. ^ http://rfbolland.com/okislugs/halgrubi.html
  11. ^ http://zipcodezoo.com/Animals/H/Halgerda_stricklandi/
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!