Ecology

Habitat

Depth range based on 76 specimens in 11 taxa.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 300 - 5062
  Temperature range (°C): 0.582 - 4.940
  Nitrate (umol/L): 17.751 - 39.691
  Salinity (PPS): 34.466 - 35.027
  Oxygen (ml/l): 2.314 - 6.259
  Phosphate (umol/l): 1.185 - 2.980
  Silicate (umol/l): 13.285 - 160.941

Graphical representation

Depth range (m): 300 - 5062

Temperature range (°C): 0.582 - 4.940

Nitrate (umol/L): 17.751 - 39.691

Salinity (PPS): 34.466 - 35.027

Oxygen (ml/l): 2.314 - 6.259

Phosphate (umol/l): 1.185 - 2.980

Silicate (umol/l): 13.285 - 160.941
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:11
Specimens with Sequences:10
Specimens with Barcodes:10
Species:7
Species With Barcodes:6
Public Records:4
Public Species:2
Public BINs:2
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bassozetus cf. levistomatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTCGGTGCTTGAGCAGGAATGGTGGGAACCGCCCTAAGCCTGCTAATTCGGGCTGAACTAAGTCAACCCGGCGCTCTTCTAGGGGACGATCAAATTTATAATGTGATCGTCACAGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGTGGTTTCGGGAACTGACTAGTTCCCCTAATGATCGGAGCCCCAGACATGGCTTTCCCTCGGATGAATAATATGAGCTTTTGACTCTTGCCCCCTTCTTTCCTCCTCCTCTTGTCATCTTCCGGAGTCGAAGCAGGCGCCGGCACAGGATGAACAGTTTATCCCCCGCTATCAGGTAACCTGGCGCACGCCGGAGCCTCCGTCGACCTTACTATCTTCTCCCTGCATTTGGCAGGCGTGTCTTCAATTCTAGGGGCCATTAATTTTATTACTACCATCATTAACATGAAACCCCCCGCTATCTCCCAGTACCAAACGCCCCTCTTCGTATGATCAGTTCTGGTGACAGCAGTCCTGCTTCTTCTATCCCTCCCAGTACTCGCTGCTGGCATTACGATGCTTTTAACCGATCGTAACTTAAATACTACATTTTTCGACCCAGCGGGTGGCGGTGATCCAATTCTTTATCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bassozetus cf. levistomatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bassozetus

Bassozetus is a genus of cusk-eels.

Species

There are currently 13 recognized species in this genus:[1]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Bassozetus in FishBase. June 2012 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!