Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Veron, 2000 YES MINERAL ARAGONITE
Le Sueur, 1821 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida, and the Bahamas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Neotype for Porites divaricata Lesueur
Catalog Number: USNM 78996
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): S. Jameson
Year Collected: 1986
Locality: North Blue Ground Range, Windward Side, Belize, Caribbean Sea, North Atlantic Ocean
Depth (m): 1.2 to 1.2
  • Neotype: Jameson, S. C. & Cairns, S. D. 2012. Neotype for Porites porites (Pallas, 1766) and Porites divaricata Le Sueur, 1820 and remarks on other western Atlantic species of Porites (Anthozoa: Scleractinia). Proc. Biol. Soc. Wash. 125 (2): 189-207.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in shallow back-reef environments, especially seagrass beds. According to Goreau and Wells (1967), occurs from 0.1-47 m, but is found most commonly from 0.5-3.0 m (Glynn 1973, Weil 1992b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0.3 - 30.4
  Temperature range (°C): 26.412 - 28.067
  Nitrate (umol/L): 0.275 - 3.505
  Salinity (PPS): 35.500 - 36.475
  Oxygen (ml/l): 4.390 - 4.682
  Phosphate (umol/l): 0.049 - 0.215
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.3 - 30.4

Temperature range (°C): 26.412 - 28.067

Nitrate (umol/L): 0.275 - 3.505

Salinity (PPS): 35.500 - 36.475

Oxygen (ml/l): 4.390 - 4.682

Phosphate (umol/l): 0.049 - 0.215

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porites divaricata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGTTATATTTAGTATTTGGGATTGGGGCAGGTATGCTCGGTACAGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACAGCACACGCTTTTATTATGATCTTTTTTTTGGTTATGCCAGTAATGATAGGGGGATTTGGGAATTGGTTGGTTCCATTATATATTGGGGCGCCTGATATGGCTTTTCCACGGCTTAATAACATTAGTTTTTGGCTGTTACCCCCTGCTTTAATATTGTTATTAGGTTCTGCTTTTGTCGAACAAGGAGCGGGTACCGGATGAACGGTTTATCCTCCTCTATCTAGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGAGGGCCCCTGGGCTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCAATCTTGATCACTGCTTTTTTATTATTATTGTCTTTGCCCGTATTAGCGGGGGCCATAACCATGCTTTTAACGGATAGAAACTTTAATACTACTTTCTTTGATCCCGCAGGGGGGGGAGATCCGATTTTATTTCAACATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Porites divaricata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean and common throughout its range, can be found in deeper waters and outside of reef habitat, and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is usually common.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined globally.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Shallow-water populations of this species are susceptible to typical threats such as pollution, bleaching, burial by sediment, hurricane damage, and loss of habitat due to coastal development, dredging, and beach renourishment, which may cause localized declines.

The genus is not particularly susceptible to bleaching, but is more prone to disease than many other corals. Coral disease has emerged as a serious threat to coral reefs worldwide and is a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the Great Barrier Reef were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification. In addition to global climate change, corals are also threatened by a number of localized threats. Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities. The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All corals are listed on CITES Appendix II. In US waters, it is illegal to harvest corals for commercial purposes (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.).

Parts of this species distribution fall within several Marine Protected Areas within its range. In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, and Buck Island Reef National Monument. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas).

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., Marine Protected Areas, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!