Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Dahlia anemones are large sea anemones, having as many as 10 to 160 tentacles. This anemone is easy to recognize when scuba diving. It has bands that run from the mouth to up and around the tentacles. Sometimes, there are even bands on the tentacles. The mouth of the dahlia anemone is found in the middle of all the tentacles, surrounded by very thick lips. The dahlia anemone is also known by the name northern red anemone.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A large anemone (base up to 15 cm diameter) with up to 160 short (up to 2 cm), stout tentacles arranged in multiples of ten. Individuals from offshore tend to be larger. The coloration is very variable, ranging through white, yellow, orange, red, blue, grey, purple and brown being either plain or more commonly in some combination. Perhaps most commonly with a red column blotched with green/grey and a prominent pattern of red lines amongst the tentacle bases. The tentacles are usually banded but may be plain. There are numerous grey warts on the column to which gravel and shell fragments stick. When the tentacles are fully retracted, the body of the anemones may be almost obscured by these adherent particles.The taxonomy and relationships of this sea anemone are in some confusion with anemones of very similar appearance and apparently reproductive biology to Urticina felina occurring on the north-west (Pacific) coast of north America. An attempt is made below to establish relationships important for using literature to support sensitivity and recoverability assessments elsewhere in this review. Stephenson (1935) identifies "Tealia (=Urticina) crassicornis" of Müller as a variety (crassicornis) of Tealia (=Urticina) felina (L.) but not the variety coriacea which is the "Tealia crassicornis" of Gosse (1860). However, Stephenson notes that, in his "var. crassicornis", the embryos develop up to a late stage in the coelenteron of the parent and later describes it as "viviparity". Since Appelöff (1900) cited in Chia & Spaulding (1972) reported that, in Europe, Tealia (=Urticina) crassicornis releases it's gametes freely into the sea (i.e. is not viviparous) and that the species they studied in the northwest USA similarly produced ova and sperm, it seems likely that their "Tealia crassicornis" has closer affinities to the British "Urticina felina" than to the species that occurs further north of the British Isles and is called "Tealia crassicornis (Müller)".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Tentacles short and stout, arranged in multiples of 10, those of the first (inner) cycle usually distinguished by the pattern on the disc, around their bases. Column divided into stout scapus and a narrow capitulum, with a prominent parapet and fosse. Scapus with numerous hollow warts which usually have gravel or other debris stuck to them. Colours very variable, plain or variegated, usually with a pattern on the disc. Size up to 200mm across tentacles, diameter of base to 120mm. This species may occur in almost any colour, or combination of colours, eg. red and green column, blue-grey disc and tentacles patterned with red, etc. When closed the gravel coating of this anemone may be all that can be seen. Sublittoral specimens may not have gravel stuck to their columns. Other anemones which coat themselves with gravel are: Anthopleura thallia, which is small, with relatively long tentacles which are arranged irregularly, colour very different from Urticina felina; Cereus pedunculatus and Sagartia troglodytes which have acontia and slender tentacles arranged in multiples of 6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Belgian Exclusive Economic Zone, Birkenfels (shipwreck), Canadian Exclusive Economic Zone [Atlantic part], Canadian part of the Arctic Ocean, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, Manicouagan, North East Atlantic, North Sea, North West Atlantic, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Saint Lawrence River, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Westerschelde, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-boreal to arctic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumarctic boreal to Cape Cod
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Alaska-California

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common on all coasts of Britain and northwest Europe (absent in the Mediterranean), possibly circumpolar but may have been confused with other species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

low intertidal-shallow sublittoral rocky coast

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 90 - 90
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 44 specimens in 2 taxa.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 0 - 366
  Temperature range (°C): 0.606 - 12.466
  Nitrate (umol/L): 1.541 - 17.262
  Salinity (PPS): 27.473 - 35.267
  Oxygen (ml/l): 4.910 - 7.823
  Phosphate (umol/l): 0.091 - 1.218
  Silicate (umol/l): 2.193 - 15.790

Graphical representation

Depth range (m): 0 - 366

Temperature range (°C): 0.606 - 12.466

Nitrate (umol/L): 1.541 - 17.262

Salinity (PPS): 27.473 - 35.267

Oxygen (ml/l): 4.910 - 7.823

Phosphate (umol/l): 0.091 - 1.218

Silicate (umol/l): 2.193 - 15.790
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Typically found on the lower shore and subtidally, particularly on shores with strong wave action or subtidal areas with strong tidal streams. Small individuals may be found as high as the mid-tide line. Attaches very firmly to rocks and boulders, typically in crevices and gullies, sometimes forming dense carpets. Occurs in estuaries where hard substrata are present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

On rocks, shells, etc. Typically a species of the lower shore and the shallow sublittoral but also from deeper water. Often forms large beds in the Laminaria zone on exposed, open coasts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This species is carnivorous, using nematocysts to paralize prey. They feed on relatively large organisms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

dioecious and oviparous.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urticina felina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAAKAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GACCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTWTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urticina felina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern red anemone

The northern red anemone or dahlia anemone, Urticina felina, is a marine invertebrate found in the north Atlantic Ocean, the North Sea and the Baltic Sea. Synonyms include Tealia crassicornis (Müller, 1776), Tealia felina (Linnaeus, 1761), and Urticina crassicornis (Müller, 1776). The colour is variable. The sea anemone lives attached to rock on the seabed from the lower tidal limit down to a depth of 100 m and also attached to other organisms. It eats small fish and crustaceans, immobilizing its prey by firing groups of stinging cells (cnidae) into them.

Contents

Description

The base is up to 120mm across and firmly adherent to the rock. Deep sea specimens are usually larger than inshore ones. The column is usually shorter than its diameter and its surface is covered in verrucae. There is a parapet at the top where the verrucae tend to be organised into rows. The verrucae usually have bits of gravel and debris attached to them and the contracted anemone has the appearance of a rounded hummock of gravel. The disc is not broader than the parapet and has up to 160 short tentacles arranged in multiples of ten. The colour is very variable; some individuals have a red column with green blotches, grey verrucae and greyish banded tentacles; others have a red column and disc with grey verrucae and white tentacles. The tentacles are often banded and in many individuals there are thin red lines on the disc visible between the tentacles.[2]

Distribution

U felina is found in the Arctic Ocean, the Baltic Sea, the North Sea and the northern Atlantic Ocean as far south as the Bay of Biscay and the Gulf of Maine.[1]

Habitat

U felina is found on rocks and boulders from the lower shore down to depths of 100 metres. It occurs in rock pools, in crevices and gullies, among the holdfasts of Laminaria spp., in caves and partly buried in gravel.[2]

References

  1. ^ a b Urticina felina (Linnaeus, 1761) World Register of Marine Species. Retrieved 2011-09-01.
  2. ^ a b Urticina felina Marine Species Identification Portal. Retrieved 2011-09-01.
  • Wildlife Fact File, 1996, Card #15
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Urticina crassicornis

Urticina crassicornis is a large and common intertidal and subtidal sea anemone formerly known as Tealia crassicornis and commonly referred to as the Christmas Anemone. Its habitat includes a large portion of global coastal areas and it lives a solitary life for up to 80 years of age.[1]

Contents

Description

Urticina crassicornis is biradially symmetrical and ranges from 2 - 12.7 cm tall with a width of 1 - 7.6 cm. This sea anemone has a solid basal plate which is always flat. Its column can be olive green with or without red spots; solid red; cream; or brown, always with small, inconspicuous tubercles but no acontia. Its tubercles are not white and do not usually accumulate bits of sand, gravel and shell. The tentacles, superior of the column and usually 100 in number, are green to opaque cream with red and white striations and semi-transparent when extended. The tentacles are conical, thick and blunt and arranged in 3 - 5 circular rings around the oral disc. The oral disc has no white striations and usually has the same color scheme as the tentacles.[1][2]

Geographical Range and Habitat

In the Pacific Ocean, Urticina crassicornis ranges from intertidal and subtidal zones of the Pribilof Islands, Alaska to Monterey, California. In the Atlantic Ocean, it is found in intertidal and subtidal zones ranging from the Arctic Ocean above Newfoundland, Canada to Cape Cod, Massachusetts and also along the coasts of Western Europe. In the state of Washington this sea anemone more commonly frequents the Puget Sound compared to the Pacific Ocean front. It is found in a lower intertidal, upper subtidal zone - 30 m deep, inhabiting well protected and shaded areas. Urticina crassicornis is a benthic and sessile organism, firmly attached only to hard substrata. This sea anemone is frequently found on docks, wood pilings, and under large rock outcroppings.[1]

Urticina crassicornis habitat.jpg

Feeding

A non-selective and opportunistic predator, Urticina crassicornis, may feed on crabs, sea urchins, mussels, gastropods, chitons, barnacles, fish, and sometimes sea stars and stranded jellies. A peculiar prey, the sun star, Pycnopodia helianthoides commonly known as the "Sunflower Star", is found in Washington state and has a size much greater than U. crassicornis, sometimes ranging up to 5 ft. in length.[3] This anemone exhibits both intracellular and extracellular digestion. Food is caught within the tentacles which then move the prey towards the oral disc.[2][4]

Predators, Parasites, and Protection

In the Pacific, certain species of both Asteroidea and Gastropoda are known predators of this anemone. Demasterias imbricata (Asteroidea) and Aeolidia papillosa (Gastropoda) are two notably frequent predator species. Urticina crassicornis senses predation through a simple nerve net spanning along its column and tentacle walls. For protection, U. crassicornis inverts its tentacles to the inside of its body column and projects nematocysts. Minimal locomotion is possible if the organism is sensing extreme danger. Some species of amphipods are parasites of U. crassicornis living within its body cavity for the benefits of housing and food. These species are not affected by the nematocysts of U. crassicornis, which has the ability to kill other species of crustacean.[5][6]

Reproduction

Urticina crassicornis produces by both asexual and sexual reproduction. In the Atlantic populations, eggs and sperm are held and fertilized within the body column. The young are brooded between the mesenteries of the body and are emitted as smallish, well developed, young anemones. Spawning occurs in the spring amongst Puget Sound populations, when eggs (yolky, 0.7 mm in diameter) and sperm are released into the sea for fertilization. Urticina crassicornis's major sperm chromosomal proteins have been found to be two specialized histone H1 proteins which indicate a strong relation to the chromosomal proteins of bird and amphibians.[7] After fertilization, a solid and ciliated blastula is created due to superficial cleavage. Six days following fertilization, a cone-shaped and benthic, larval planula develops. These planula then settle onto small rocks or the empty tubes of some annelid worms and rapidly develop into small anemones. 12 days after settlement, 8 tentacles appear. Further growth is slow – two months after settlement, 12 tentacles appear and the anemone is 0.88 mm in diameter; one year after settlement, the anemone has 35 tentacles and is 10 mm in diameter. Growth is proportional to food intake, not age. When starved, this anemone can stay alive for 9 months but does not grow. Urticina crassicornis is sexually mature with a diameter of 10 – 15 mm, being at least one year old.[1]

Footnotes

  1. ^ a b c d Abbot, Donald P., Hadderlie, Eugene C., Morris, Robbert H. Intertidal Invertebrates of California. Stanford, CA: Stanford University Press, 1980.
  2. ^ a b Cowles, David. Urticina Crassicornis. Walla-Walla, WA: 2005.
  3. ^ Markovich, Karlee. Urticina crassicornis. Juneau, AK: University of Alaska Southeast, 2002.
  4. ^ Kozloff, Eugene N. Marine Invertebrates of the Pacific Northwest. Seattle, WA: University of Washington Press, 1996.
  5. ^ Nybakken, James W. Diversity of the Invertebrates. Dubuque, IA: Times Mirror Higher Education Group, Inc., 1996.
  6. ^ Verill, A.E. On the Parasitic Habits of Crustacea. Chicago, IL: The University of Chicago Press, 1869.
  7. ^ Ausio, Juan, Rocchini, Corinne, Zhang, Fan. Two Specialized Histone H1 proteins are the major sperm of the sea anemone Urticina (Tealia) crassicornis. Victoria, BC: Department of Biochemistry and Microbiology, University of Victoria, 1995

References

  1. Nybakken, James W. Diversity of the Invertebrates. Dubuque, IA: Times Mirror Higher Education Group, Inc., 1996.
  2. Abbot, Donald P., Hadderlie, Eugene C., Morris, Robbert H. Intertidal Invertebrates of California. Stanford, CA: Stanford University Press, 1980.
  3. Kozloff, Eugene N. Marine Inveretebrates of the Pacific Northwest. Seattle, WA: University of Washington Press, 1996.
  4. Cowles, David. Urticina crassicornis. Walla-Walla, WA: Walla-Walla University, 2005.
  5. Ausio, Juan, Rocchini, Corinne, Zhang, Fan. Two Specialized Histone H1 proteins are the major sperm of the sea anemone Urticina (Tealia) crassicornis. Victoria, BC: Department of Biochemistry and Microbiology, University of Victoria, 1995
  6. Chia, Fu-Shiang, Spaulding, James G. Development and Juvenile growth of the sea anemone, Tealia Crassicornis. Marine Biological Laboratory, 1972.
  7. Verill, A.E. On the Parasitic Habits of Crustacea. Chicago, IL: The University of Chicago Press, 1869.
  8. Markovich, Karlee. Urticina crassicornis. Juneau, AK: University of Alaska Southeast, 2002.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Urticina columbiana

Urticina columbiana, common names crusty red anemone, columbia sand anemone, sand anemone, and the sand-rose anemone,[1] is a species of sea anemone in the family Actiniidae.[2][3]

Contents

Description

This species can grow to 25 cm high and can reach a diameter of 1 metre, making it one of the largest species of anemone.[4] The tentacles are long and slender, taking the shape of a red column. The tubercles on the column are big and rough, having a white colour. They are organized in circular rows which protrude from the column. Unlike other species which may accumulate matter, the tubercles do not attach to ocean debris such as bits of shell. The column is red in colour.[3]

No special spherules are present around the external rim of the oral disk beyond the tentacles.[3]

Distribution

Urticina columbiana species occurs in the Pacific Ocean from Vancouver Island to Baja California.[3]

Habitat

This species is found between the subtidal zone to a depth of 45 metres. It normally lives among shells, in soft sand or mud. It is usually partially buried, with tubercles mostly under the sea floor.[3]

Symbionts

The candy stripe shrimp (Lebbeus grandimanus) is one of the symbionts of this species.[3]

References

  • Kozloff, Eugene N., 1987. Marine Invertebrates of the Pacific Northwest. University of Washington Press, Seattle, WA. 511 pp. ISBN 0-295-96530-4
  • Harbo, Rick M., 1999, 2011. Whelks to Whales: Coastal Marine Life of the Pacific Northwest. Harbour Publishing, Madeira Park, BC, Canada. Paperback, 245 pp. ISBN 1-55017-183-6.
  • Lamb, Andy and Bernard P. Hanby, 2005. Marine Life of the Pacific Northwest. A Photographic Encyclopedia of Invertebrates, Seaweeds and Selected Fishes. 398 pp. Harbour Publishing. ISBN 1-55017-361-8.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!