Overview

Comprehensive Description

Biology: Nematocysts

More info
LocationImageCnidae TypeRange of
Lengths (m)
Range of
Widths (m)
nNState
Hand C. H., 1955
Actinopharynx
basitrichs  27.5 - 43  x  3.5 - 4.5  71 / Unfired
microbasic p-mastigophores  23 - 36  x  4.5 - 5  64 / Unfired
Column
basitrichs  16 - 23.5  x  2 - 3  65 / Unfired
Filaments
basitrichs  17 - 28  x  2 - 3.5  65 / Unfired
microbasic p-mastigophores  20 - 33.5  x  3.5 - 4.5  70 / Unfired
microbasic p-mastigophores  22 - 48  x  3.5 - 5  68 / Unfired
Tentacles
basitrichs  21.5 - 30.5  x  2 - 3  57 / Unfired
spirocysts  17.5 - 38  x  1.5 - 3  60 / Unfired
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: Shells or debris is occasionally found adhered to the tubercles, but not usually and not strongly. Juvenile painted greenlings are often associated with this anemone, and adults may sleep near its base. The eggs are very large (over 1.2 mm diameter) and yolky. It has not been observed brooding the eggs.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This large anemone has no acontia. The column is red with smooth white tubercles in longitudinal rows. The margin of the oral disk has no white spherules. The tubercles usually do not hold sand, shells, or other debris. The oral disk is red and has no radiating white stripes. The slender tentacles are red, unbanded but with sometimes a yellow tinge at the base and pinker at the tips. Diameter to 10 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: SE Alaska to San Diego, CA; North Atlantic

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

The species referred to as Urticina lofotensis is actually Cribrinopsis albopunctata Sanamyan & Sanamyan, 2006; Urticina lofotensis is a junior synonym of U. eques, and does not occur in the Pacific - see link to Actiniaria.com web site
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Urticina columbiana has rough white tubercles in circumferential rows. Urticina piscivora and Urticina crassicornis have inconspicuous tubercles which are not white, and U. crassicornis also has transverse bands on its tentacles and greenish blotches on its column.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 68 samples.

Environmental ranges
  Depth range (m): 0 - 9
  Temperature range (°C): 9.967 - 10.345
  Nitrate (umol/L): 5.774 - 7.622
  Salinity (PPS): 31.692 - 32.028
  Oxygen (ml/l): 6.534 - 6.616
  Phosphate (umol/l): 0.883 - 0.974
  Silicate (umol/l): 12.975 - 16.001

Graphical representation

Depth range (m): 0 - 9

Temperature range (°C): 9.967 - 10.345

Nitrate (umol/L): 5.774 - 7.622

Salinity (PPS): 31.692 - 32.028

Oxygen (ml/l): 6.534 - 6.616

Phosphate (umol/l): 0.883 - 0.974

Silicate (umol/l): 12.975 - 16.001
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to 15 m. Mostly subtidal.

Habitat: Rocky, exposed coast, concrete pilings, marina floats. In the intertidal, is usually in surge channels and on vertical rock faces.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Urticina lofotensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Urticina lofotensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GATCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTTTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Urticina lofotensis

Urticina lofotensis is a species of sea anemone in the family Actiniidae. It is commonly known as the white-spotted rose anemone or strawberry anemone.[2]

Taxonomy[edit]

According to one authority, the populations of Urticina lofotensis found in the Pacific Ocean are not the same species as those in the Atlantic Ocean. They are considered to be conspecific with Cribrinopsis albopunctata, a new species from Kamchatka.[3] The same authority considers that the name Urticina lofotensis is invalid for the species found in European waters and is a junior synonym of Urticina eques.[4] This is not accepted by the World Register of Marine Species [1] nor the Encyclopedia of Life.[5]

Description[edit]

Tentacles retracted

Urticina lofotensis has a smooth, red column with vertical rows of white tubercles. In contrast to other similar species, the tubercles are not adhesive and do not normally attract gravel and shell fragments. There are no acontia with stinging nematocysts protruding through the body wall. The oral disk is plain red and the tapering tentacles are red and have no transverse striations. This is a large sea anemone with a diameter of up to 10 cm (4 in) and 15 cm (6 in) length.[2]

Distribution and habitat[edit]

Urticina lofotensis is found in the North Atlantic Ocean and the Pacific coast of North America. It occurs between low water mark and a depth of about 15 m (49 ft). It is found on rocks and pilings, in crevices and gullies and favours exposed habitats with fast moving water.[2]

Biology[edit]

Urticina lofotensis is dioecious. In California, female ripeness occurs in December as the sea temperature begins to fall. The large eggs, 1,200 µm (0.047 in) in diameter, are produced at intervals, and the release of sperm by the males follows shortly afterwards. In some females, large oocytes also release eggs at other times of year. The gametes emerge through the mouth of the anemone and fertilisation is external. The eggs develop into planula larvae which drift with the current before settling and growing into new individuals.[6]

Ecology[edit]

Juveniles of the painted greenling (Oxylebius pictus), a species of fish, have a facultative association with Urticina lofotensis. They are often found among the tentacles or close to the column, especially when resting and inactive at night. According to researcher Joel Elliot, these associations occurred mainly in moderately exposed locations where the sea anemones and fish were both numerous; the large anemone offers the fish protection from predators and provides a safe environment for it to feed on copepods and other small invertebrates that are also associated with the anemone.[7] The research indicated that the fish seemed to be unharmed by the anemone's nematocysts. The anemones themselves were thought not to derive any benefits from the arrangement.[7]

References[edit]

  1. ^ a b c Urticina lofotensis (Danielssen, 1890) World Register of Marine Species. Retrieved 2011-10-29.
  2. ^ a b c Urticina lofotensis (Danielssen, 1890) Walla Walla University. Retrieved 2011-10-29.
  3. ^ Sanamyan, N. P.; K. E. Sanamyan (2006). "The genera Urticina and Cribrinopsis (Anthozoa: Actiniaria) from the north‐western Pacific". Journal of Natural History, 40 (7-8): 359–93. doi:10.1080/00222930600703532. 
  4. ^ Cribrinopsis albopunctata Sanamyan & Sanamyan, 2006 Actiniaria.com. Retrieved 2011-10-29.
  5. ^ Urticina lofotensis Encyclopedia of Life. Retrieved 2011-10-29.
  6. ^ Wedi, Steven E.; Dapne F. Dunn (1982). "Gametogenesis and reproductive periodicity of the subtidal sea anemone Urticina lofotensis (Coelentrata: Actiniaria) in California". Biological Bulletin 165: 458–72. doi:10.2307/1541212. 
  7. ^ a b Elliott, Joel (1992). "The role of sea anemones as refuges and feeding habitats for the temperate fish Oxylebius pictus". Environmental Biology of Fishes 35 (4): 381–400. doi:10.1007/BF00004991. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!