Ecology

Habitat

Depth range based on 154 specimens in 5 taxa.
Water temperature and chemistry ranges based on 73 samples.

Environmental ranges
  Depth range (m): 1 - 135.5
  Temperature range (°C): 22.098 - 28.385
  Nitrate (umol/L): 0.129 - 9.015
  Salinity (PPS): 34.108 - 35.284
  Oxygen (ml/l): 2.138 - 4.711
  Phosphate (umol/l): 0.064 - 1.010
  Silicate (umol/l): 1.309 - 16.261

Graphical representation

Depth range (m): 1 - 135.5

Temperature range (°C): 22.098 - 28.385

Nitrate (umol/L): 0.129 - 9.015

Salinity (PPS): 34.108 - 35.284

Oxygen (ml/l): 2.138 - 4.711

Phosphate (umol/l): 0.064 - 1.010

Silicate (umol/l): 1.309 - 16.261
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:99Public Records:48
Specimens with Sequences:82Public Species:11
Specimens with Barcodes:82Public BINs:10
Species:13         
Species With Barcodes:12         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Secutor cf. indicius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Secutor cf. insidiator JS-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTATTTGGTGCTTGAGCTGGTATAGTAGGGACCGCCCTAAGCCTGCTCATCCGGGCAGAAYTAAGCCAACCAGGCGCYCTCCTAGGGGAC---GACCACATTTATAATGTYATTGTCACYGCRCATGCATTCGTAATAATTTTCTTTATAGTMATACCCATTATAATYGGAKGCTTYGGAAACTGACTAATTCCACTAATGATTGGAGCCCCAGACACAGCATTCCCACGAATAAAYAACATAAGCTTTTGACTCCTTCCCCCGTCATTCCTTCTRCTRYTGGCRTCTTCCGGAATTGAGGCTGGAGCAGGAACAGGATGAACGGTTTACCCCCCTCTAGCAGGCAATCTTGTCCACGCAGGAGCATCCGTTGACYTAACAATYTTCTCMCTNCATCTAGCRGGAATTTCYTCAATCCTRGGYGCYATYKACYTTATTACCACAATTATYAAYATAAAACCCCCAGCYATTTCACAATTCCAAACGCCCCTATTCGTGTGAGCTGTCCTTATTACAGCAGTTCTTCTTCTTCTTTCCTTACCAGTCCTCGCAGCGGGAATTACTATGCTTCTAACTGACCGAAACCTGAACACCACCTTCTTYGACCCCGCAGGAGGAGGAGACCCTATCCTGTAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Secutor cf. insidiator JS-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Secutor cf. ruconius JS-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTATTTGGTGCCTGAGCTGGTATAGTCGGAACTGCCTTAAGCCTACTCATCCGAGCAGAACTAAGCCAACCCGGCGCTCTCTTAGGAGAT---GACCATATTTACAACGTTATCGTCACTGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGGCTACTCCCCCCATCATTCCTTTTACTATTGGCATCTTCCGGAATTGAAGCTGGTGCGGGAACAGGATGGACTGTATACCCCCCTCTAGCGGGCAATCTTGCTCACGCAGGAGCATCCGTTGACTTAACAATTTTCTCACTGCATCTAGCAGGAATTTCCTCTATCCTGGGCGCTATCAATTTTATTACAACAATCATCAATATAAAACCCCCAGCCATTTCACAATTCCAAACCCCACTATTTGTTTGAGCCGTCTTAATTACAGCAGTACTTCTTCTTCTTTCCCTACCCGTTCTTGCTGCCGGAATTACAATACTATTAACTGACCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGATCCTATCCTCTAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Secutor cf. ruconius JS-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Secutor

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Secutor (genus)

Secutor is a genus of ponyfishes native to the Indian Ocean and the western Pacific Ocean.[1]

Species[edit]

There are currently seven recognized species in this genus:[1]

References[edit]

  1. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2013). Species of Secutor in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!