Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

The geographic range of Urbanus proteus is from Argentina in South America, throughout Central America and the West Indies, up to the southern parts of North America (Carter 1992). These butterflies are abundant and year round residents of southern Texas and Florida, but during the summer months they can be found as far as Illinois and New York. However, they do not survive long in these northen areas because of the colder temperatures (Tveten and Tveten 1996).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Tveten, J., G. Tveten. 1996. Butterflies of Houston & Southeast Texas. Austin, Texas: University of Texas Press.
  • Carter, D. 1992. Eyewitness Handbooks Butterflies and Moths. Boston, Massachusettes: Dorling Kindersley, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Long-tailed skippers have a broad head and a hairy body with tufts of hair at the base of their curved-tip antennae. The wingspan of these hairy butterflies is between 4 - 5.4 cm (Klots 1951). The top side of Urbanus proteus is dark brown with lighter brown spots. Wing bases, the part of the wing attached to the body, on the top are an irridescent green. Undersides of the butterflies are a lighter brown with dark bands and spots.

Larvae are yellowish green with a black line down the dorsal side of the body. The head is maroon and black and there are yellow and orange/red side strips. The reddish black head is also accompanied by an orange or yellow spot on each side. The pupa of this species is a reddish-brown and is covered with a waxy whitish powder (Scott 1986).

Range wingspan: 4 to 5.4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Klots, A. 1951. A Field Guide to the Butterflies of North America, East of the Great Plains. Boston, Massachusettes: Houghton Mifflin Company.
  • Scott, J. 1986. The Butterflies of North America: A Natural History & Field Guide. Standford, California: Standford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The habitats of these butterflies include brushy fields, woodland edges, coastal dunes, and even suburban gardens (Tveten and Tveten 1996). They are not found in high elevations or altitudes because of the cool temperatures (Forestieno and Sbordoni 1998).

Range elevation: 0 (low) m.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: suburban

  • Forestieno, S., V. Sbordoni. 1998. Butterflies of the World. Willowdale, Ontario: Firefly Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: A migratory transient breeder that can utilize almost any habitat with suitable legumes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The adult butterflies have no specific attraction to certain plants. As long as there is a flowering plant with nectar, the butterfly will stop frequently (Tventen and Tventen 1996).

Larvae are found on Leguminosae and Fabacceae (Neck 1996). Some examples of common larval plants are Pisum, Desmodium, Bauhinia, cultivated beans, and any other viney plants (Klots 1951).

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Adults pollinate many plant species, while larvae feed on many plant species.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larvae are found to be preyed on by certain species of wasps and stink bugs.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males find potential mates through olfaction.

Communication Channels: chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Females lay up to 20 eggs (commonly in clusters of 2-6) underneath the leaves of the host plant (Scott 1986). Eggs are cream to bluish-green and are hemispherical and finely sculpted (Forestieno and Sbordoni 1998). Once the larvae hatch, they eat the leaves from their nests made of rolled leaves and supportive silk strands. The pupa forms a cocoon out of bits of leaves and silk strands. The life cycle of the butterfly is about thirty days (Capinera 1996).

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male Urbanus proteus are territorial and stake out sites in places where females are common during the spring mating season. The males find the females through olfaction as they perch 1-2 meters from the ground on foliage and await passing females (Tveten and Tveten 1996). Males and females join in a courtship dance that involes spiraling upward together and eventually falling to the ground, where they mate. Females lay up to 20 eggs (commonly in clusters of 2-6) underneath the leaves of the host plant (Scott 1986). Eggs are cream to bluish-green and are hemispherical and finely sculpted (Forestieno and Sbordoni 1998). Once the larvae hatch, they eat the leaves from their nests made of rolled leaves and supportive silk strands. The pupa forms a cocoon out of bits of leaves and silk strands. The life cycle of the butterfly is about thirty days (Capinera 1996).

Average eggs per season: 20.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Beyond choosing sites to lay eggs, butterflies offer no parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Tveten, J., G. Tveten. 1996. Butterflies of Houston & Southeast Texas. Austin, Texas: University of Texas Press.
  • Forestieno, S., V. Sbordoni. 1998. Butterflies of the World. Willowdale, Ontario: Firefly Books.
  • Scott, J. 1986. The Butterflies of North America: A Natural History & Field Guide. Standford, California: Standford University Press.
  • Capinera, J. 1996. "Featured Creatures" (On-line). Accessed April 3, 2001 at http://creatures.ifas.ufl.edu/veg/bean/beanleaf.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urbanus proteus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 428 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCATTAATAATAGGTGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTGCCCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Urbanus proteus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 337
Specimens with Barcodes: 456
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The butterfly and its habitat are not listed as threatened. The adaptation of the Urbanus proteus to suburban gardens exempts it from becoming threatened in its wild habitat.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Since this species lays its eggs under bean plants, it can have a devastating effect on bean crop yield (Scott 1986). Although it takes many larvae to make an impact on the yield, they are still considered pests of bean plants. In terms of biological control, these larvae are found to be preyed on by certain species of wasps and stink bugs. The beanleaf roller larvae can also be infected with a virus that can kill up to 50% of the population. Common insecticides are also effective on killing the larvae (Capinera 2001).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-Tailed Skippers have no positive influence on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Long-tailed Skipper

The Long-tailed Skipper (Urbanus proteus) is a spread-winged skipper butterfly found throughout tropical and subtropical South America, south to Argentina and north into the southern part of the United States of America. It cannot live in areas with prolonged frost. It is a showy butterfly, with wings of light brown tinted with iridescent blue, and two long tails extending from the hindwings. The robust body is light blue dorsally. It has a large head, prominent eyes, and a wingspan between 4.5 and 6 centimeters.

LongTailedSkipper.jpg
Urbanus proteus.JPG
Pupa
Caterpillar

Life cycle[edit]

It lays white or yellow eggs, singly or in small clusters, which hatch into a caterpillar with a yellowish body and large, dark head. After two to three weeks, the caterpillar forms a pupa. Its pupa is contained in a rolled leaf and covered in fine bluish hairs. The pupa stage may last from one to three weeks, after which the adult emerges.

The caterpillar of this skipper is a common pest of crops, especially beans, in the southern United States. For this reason, it is sometimes called the bean leafroller in that area. The caterpillars are also known to attack ornamental plants in the legume family such as wisteria and butterfly pea. The caterpillars feed on leaves and then roll the leaves around themselves, lining the cavity with silk, to pupate. The adults feed on nectar from flowers.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!