Ecology

Habitat

Depth range based on 298 specimens in 18 taxa.
Water temperature and chemistry ranges based on 179 samples.

Environmental ranges
  Depth range (m): 0.45 - 160
  Temperature range (°C): 14.724 - 28.385
  Nitrate (umol/L): 0.164 - 10.770
  Salinity (PPS): 32.039 - 38.549
  Oxygen (ml/l): 2.079 - 5.557
  Phosphate (umol/l): 0.083 - 1.170
  Silicate (umol/l): 0.777 - 17.807

Graphical representation

Depth range (m): 0.45 - 160

Temperature range (°C): 14.724 - 28.385

Nitrate (umol/L): 0.164 - 10.770

Salinity (PPS): 32.039 - 38.549

Oxygen (ml/l): 2.079 - 5.557

Phosphate (umol/l): 0.083 - 1.170

Silicate (umol/l): 0.777 - 17.807
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:1031
Specimens with Sequences:689
Specimens with Barcodes:377
Species:50
Species With Barcodes:47
Public Records:224
Public Species:19
Public BINs:20
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura cf. leoparda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura cf. uarnacoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Himantura cf. gerrardi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTATCTTCGGTGCATGAGCAGGGATAGTGGGCACTGGTCTTAGTCTGCTCATTCGAACAGAGCTAAGCCAACCAGGTGCACTACTAGGTGATGATCAGATCTATAACGTGATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATTGGAGGCTTTGGTAACTGGCTCGTTCCCCTAATAATCGGTGCCCCAGACATAGCCTTTCCTCGAATAAATAACATAAGTTTCTGACTTCTACCCCCATCCTTTCTCCTACTTTTGGCCTCTGCTGGAGTTGAGGCAGGAGCTGGAACAGGTTGAACTGTCTACCCCCCACTAGCTGGTAACCTAGCACATGCCGGAGCTTCAGTAGACCTGGCAATCTTCTCACTGCACCTAGCCGGTGTCTCTTCTATCCTGGCCTCCATTAATTTTATCACCACAATTATCAACATAAAACCACCAGCAATCTCACAATATCAAACACCTCTCTTTGTCTGATCAATCCTCATTACAGCTGTACTTCTCTTACTATCCCTCCCTGTCTTAGCAGCAGGCATTACAATACTTCTCACAGACCGTAACCTCAACACAACCTTCTTTGACCCTGCAGGAGGAGGTGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura cf. gerrardi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura cf. hortlei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura cf. pastinacoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Himantura

Himantura is a genus of stingray in the family Dasyatidae, commonly known as the whiprays. They are distinguished from other stingrays by a long, slender tail without tail folds. Himantura species are very morphologically diverse and the genus may be polyphyletic. Most species are found in the western Pacific and the Indian Ocean.[1]

Species[edit]

There are currently 28 recognized species in this genus:[2][3][4]

References[edit]

  1. ^ Compagno, L.J.V. and Roberts, T.R. (1982). "Freshwater stingrays (Dasyatidae) of Southeast Asia and New Guinea, with description of a new species of Himantura and reports of unidentified species". Environmental Biology of Fishes 7 (4): 321–339. doi:10.1007/BF00005567. 
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2013). Species of Himantura in FishBase. April 2013 version.
  3. ^ a b Borsa, P., Durand, J.-D., Shen, K. N., Arlyza, I. S., Solihin, D. D. & Berrebi, P. (2013): Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence. Comptes Rendus Biologies, 336: 82–92.
  4. ^ a b Last, P.R. & White, W.T. (2013): Two new stingrays (Chondrichthyes: Dasyatidae) from the eastern Indonesian Archipelago. Zootaxa, 3722 (1): 1–21.
  5. ^ Last, P.R., Manjaji-Matsumoto, B.M. & Moore, A.B.M. (2012): Himantura randalli sp. nov., a new whipray (Myliobatoidea: Dasyatidae) from the Persian Gulf. Zootaxa, 3327: 20–32.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!