You are viewing this Genus as classified by:

Overview

Brief Summary

The genus Hippocampus is made up of 47 species of distinctive marine fish commonly known as the seahorses. They are found world-wide in protected, shallow tropical and temperate waters, especially estuaries, mangrove swamps, coral reefs, and eel grass beds. Seahorses do not have scales, instead have bony plates for protection, and swim slowly in an upright posture. They spend much of their time stationary, using their tails to attach themselves to corals, grasses, or other objects. They are ambush predators and feed on small crustaceans and other invertebrates.

Fossil and molecular dating evidence indicate that sea horses diverged from their closest relatives, the pipefish, in the Oligocene, about 13 million years ago.

Sea horses are well-known for their paternal care. After several days of courting, the female seahorse oviposits somewhere between a dozen and a thousand eggs into the male’s egg pouch, which is located on his pouch. The male regulates the water salinity in the pouch and incubates the eggs for 1-6 weeks, depending on the species. After the fry (typically 100-200, but this varies by species) emerge, he no longer provides any more care. Sea horses often form monogamous pairs for the breeding season, but many species trade partners readily and do not pair for life.

Sea horses are found in the aquarium trade, however they are difficult to keep. They can be bred in captivity, but tend to be cheaper when harvested from the wild. Sea horses are collected and used as aphrodisiacs and cures for respiratory ailments in traditional Chinese medicinal purposes; between collecting and destruction of environments, some are thought to be declining in numbers. CITES set up a set of trade recommendations with guidelines for international trade of all sea horse species in 2004.

A basal seahorse clade, now comprised of six species, contains the pygmy seahorses, which are less than 15 mm tall. Because of their small size, camouflage and commensurate living habits with colonial hydrozoans and coralline algae these species have been noticed and classified only since 1997.

(International Workshop on CITES Implementation for Seahorse Conservation and Trade 2004; Turner 2005; US Fish and Wildlife Service Office of Law Enforcement, 2004; Wikipedia 2012)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The genus Hippocampus is comprised of seahorses, bony fishes with equine profiles that swim upright. There are nearly 50 species of seahorses and they are mainly found in shallow tropical and temperate waters throughout the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 701 specimens in 41 taxa.
Water temperature and chemistry ranges based on 308 samples.

Environmental ranges
  Depth range (m): 0 - 2543
  Temperature range (°C): 3.048 - 28.408
  Nitrate (umol/L): 0.054 - 27.458
  Salinity (PPS): 32.507 - 37.543
  Oxygen (ml/l): 1.101 - 6.494
  Phosphate (umol/l): 0.072 - 2.067
  Silicate (umol/l): 0.756 - 22.128

Graphical representation

Depth range (m): 0 - 2543

Temperature range (°C): 3.048 - 28.408

Nitrate (umol/L): 0.054 - 27.458

Salinity (PPS): 32.507 - 37.543

Oxygen (ml/l): 1.101 - 6.494

Phosphate (umol/l): 0.072 - 2.067

Silicate (umol/l): 0.756 - 22.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:216
Specimens with Sequences:185
Specimens with Barcodes:185
Species:40
Species With Barcodes:34
Public Records:142
Public Species:28
Public BINs:26
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus SL sp. A

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTATATTTAGTGTTTGGTGCTTGAGCTGGTATAGTAGGAACTGCCCTCAGTTTACTCATCCGAGCTGAATTAAGTCAACCGGGAGCTTTACTAGGTGATGATCAAATCTATAATGTTATTGTAACTGCTCATGCTTTCGTAATGATTTTTTTTATAGTCATACCTATTATAATTGGAGGTTTTGGTAACTGATTAATTCCTTTAATAATTGGAGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTACTGCCTCCTTCTTTCCTTCTCCTTTTAGCTTCATCAGGTGTAGAAGCTGGGGCAGGTACAGGTTGAACTGTTTATCCTCCATTAGCTGGGAATTTAGCTCATGCTGGTGCATCTGTTGATTTAACAATTTTTTCTCTTCATTTAGCAGGTGTATCCTCAATTCTAGGAGCTATTAATTTCATTACAACTATTATTAATATAAAACCTCCTTCTATTTCACAATATCAAACACCTTTATTTGTATGAGCAGTTCTAGTAACTGCTGTATTATTATTATTATCACTCCCTGTTTTAGCAGCTGGTATTACTATACTTTTAACCGATCGGAATTTAAATACAACATTTTTTGACCCTTCCGGAGGGGGAGACCCTATCTTATATCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus SL sp. A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. fuscus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATTCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCACCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGCAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATTAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGGGCAGTTTTAGTAACCGCAGTTCTACTTTTACTGTCATTACCTGTACTAGCAGCCGGGATCACTATGCTTCTTACAGACCGAAACTTAAACACAACATTCTTTGACCCTTCCGGAGGGGGAGATCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. fuscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. borboniensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATTCGGGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCACCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGCAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATTAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGGGCAGTTTTAGTAACCGCAGTTCTACTTTTACTGTCATTACCTGTACTAGCAGCCGGGATCACTATGCTTCTTACAGACCGAAACTTAAACACAACATTCTTTGACCCTTCCGGAGGGGGAGATCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. borboniensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. barbouri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTATTAATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTGGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTTGTAATAATTTTTTTTATGGTAATACCAATTATGATTGGGGGTTTTGGTAATTGATTAGTTCCTTTAATAATCGGAGCGCCTGATATAGCCTTCCCTCGGATAAACAATATGAGTTTTTGATTATTACCACCTTCTTTCCTCCTTCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGAACTGTCTACCCCCCATTAGCAGGCAACCTAGCACATGCTGGAGCTTCAGTGGACTTAACAATTTTCTCCCTCCATTTAGCAGGTGTTTCGTCAATCCTCGGAGCTATTAACTTTATTACTACTATTATTAATATAAAACCCCCATCAATCTCACAATATCAAACACCACTGTTTGTATGAGCAGTTTTAGTAACTGCAGTTCTACTCTTACTATCCCTACCTGTATTAGCAGCTGGTATTACTATGCTTTTAACAGATCGGAATTTAAATACAACATTCTTTGACCCTTCTGGAGGAGGAGATCCTATCCTTTATCAGCATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. barbouri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pygmy seahorse

The pygmy seahorses comprise several species of tiny seahorse in the syngnathid family or Syngnathidae (seahorses and pipefish). Family Syngnathidae is part of order Syngnathiformes, which contains fishes with fused jaws that suck food into tubular mouths. They are found in Southeast Asia in the Coral Triangle area. They are some of the smallest seahorse species in the world, typically measuring less than 2 centimetres (0.79 in) in height.[1][2]

The first pygmy seahorse known to science was Hippocampus bargibanti. At least six more species were named after 2000. The first species discovered lives exclusively on fan corals and matches their colour and appearance. So effective is pygmy seahorse camouflage that it was discovered only when a host gorgonian was being examined in a laboratory. Other species live on soft corals or are free-ranging among seagrasses and algae.[3]

Description[edit]

The pygmy seahorse is both tiny and well camouflaged. It is very difficult to spot amongst the sea grasses, soft corals, or gorgonians (sea fans) that it inhabits. Other distinctive pygmy seahorse characteristics include a fleshy head and body, a very short snout, and a long, prehensile tail. With their short snouts, they have the appearance of baby animals. Pygmy seahorses are 14–27 millimetres (0.55–1.06 in) long from the tip of the tail to the end of the snout, so that their vertical height while swimming is still smaller.[4] An adult may be as small as 13 millimetres (0.51 in) long.[5]

True pygmy seahorses have distinctive morphological markers.[4]

  • Unlike other seahorses, they have a single gill opening on the back of the head, instead of two on the sides.
  • Males brood their young inside their trunk, instead of in a pouch on the tail.

Males and females are distinguished by openings at the bottom of the trunk: females have a tiny, raised round pore for extruding eggs and males have a fore-and-aft slit for accepting them.[4]

Species[edit]

Well-camouflaged pygmy seahorse on a gorgonian coral Muricella sp. See this image to identify the pygmy seahorse.
A pygmy seahorse found at a depth of around 32 metres (105 ft) at Tulamben near a shipwreck
Pygmy seahorse found while diving Nudi's Fall, Lembeh, Indonesia

The known species are these:

  • Denise's pygmy seahorse (Hippocampus denise) was described in 2003. Its range is from Borneo to New Guinea, Solomon Islands and Palau. They must live on gorgonian corals but have been found on eight different genera: Acanthogorgia, Annella, Echinogorgia, Ellisella, Melithaea, Muricella, Verrucella and Villogorgia. Each pygmy seahorse stays on the same coral for its entire adult life. The young settle onto a host and over a few days take on its exact colour and texture, accounting for the wide variation in adults, but typically red, orange, or yellow. They grow up to 2.4 cm long.[8] They have smooth skin with few tubercles. They have a bent, asymmetrical appearance. Females have a slender body with a small bulge at the base of the trunk, while males are rounder. They are found at depths of 13–90m. Underwater photographer Denise Tackett noticed that they were different from H. bargibanti and brought them to the attention of scientists.[9]
  • Pontoh's pygmy seahorse (Hippocampus pontohi) was named in 2008. This species is free-living, not associated with gorgonian corals, and tends to live in shallower water (3m - 20m). They are found in the Coral Triangle area: Indonesia, Papua New Guinea, Solomon Islands and Fiji. They can be found anywhere on tropical reefs in their range. However, they are most often seen in pairs or small groups in clumps of the calcareous alga, Halimeda[10] and on the hydroid Aglaephenia cupressina. They are often found where Halimeda grows out of reef walls. Divers report them on many types of seagrass and algae, moving frequently to different hitching spots.[11] They are almost identical in shape to the Severn's pygmy seahorse, but are a different colour: white with pink or yellow patches.[10] They lack tubercules. The trunk is round but thin when viewed from behind. They are seen in high-current areas at depths of 11-25m.[11]
  • Satomi's pygmy seahorse (Hippocampus satomiae), named in 2008, are the world's smallest seahorse at up to 1.4 cm. This is a free-living species that is found near coral walls with soft corals. They are nocturnal and very active at night. They have been found in only a few places in Indonesia and northern Borneo. They can be brown to pale with specific markings such as a dark spot in front of each relatively large eye.[12] Spines cover the entire body. Both males and females have a round trunk. They are found from 15 – 20 meters deep in groups of 3 to 5.[13]
  • Severn's pygmy seahorse (Hippocampus severnsi) is a free-living species described in 2008. They are almost the same shape as Pontoh's pygmy seahorse, but are a different colour: pale brown with red and orange patches. They can be found on any part of the reef, but often on hydroids and algal turf in pairs or small group. They are no larger than 1.7 cm.[14]
  • Walea soft coral pygmy seahorse (Hippocampus waleananus) lives on and around soft coral. The soft coral have fat stems and this seahorse has a correspondingly long tail. They vary from pale pink to yellow. It has a very small range: it lives only in the Tomini Gulf of central Sulawesi, Indonesia, and depends on the continued existence of soft corals there.[15]
  • Coleman's pygmy seahorse (Hippocampus colemani) is probably restricted to Lord Howe Island off the east coast of Australia. However, there are unconfirmed reports from eastern Papua New Guinea and Taiwan.[4] This pygmy seahorse was found in the lagoon of Lord Howe Island living on seagrass, mainly Zostera and Halophila. It was described in 2003. It is white, yellow, or gold with white spots outlined in red. It has a very small snout and well-defined nose spine. Both males and females are rotund.[16]
  • Japanese pygmy seahorse has been discovered but not officially described.[4]

Other dwarf species[edit]

Other small seahorses are sometimes called pygmy seahorses, but lack the single gill opening and trunk brooding that distinguish the true pygmy seahorse. They can be called dwarf seahorses:[4]

References[edit]

  1. ^ Lourie, S.A., Foster, S.J., Cooper, E.W.T. and Vincent, A.C.J. (2004) A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America, Washington D.C..
  2. ^ Bargibant's seahorse. Accessed 2012-11-02.
  3. ^ Reijnen, B.T., van der Meij, S.E.T., van Ofwegen, L.P. (2011) "Fish, fans and hydroids: host species of pygmy seahorses." ZooKeys 103: 1-26.
  4. ^ a b c d e f Smith, Richard E. Pygmy seahorse research
  5. ^ Fishes of Australia: H. bargibanti. Accessed 2012-11=02.
  6. ^ Smith, Richard E. Hippocampus bargibanti Accessed 2012-10-31.
  7. ^ Common Pygmy Seahorse Accessed 2012-10-31.
  8. ^ Smith, Richard E. Hippocampus denise Accessed 2012-10-31.
  9. ^ Denise's Pygmy Seahorse Accessed 2012-10-31.
  10. ^ a b Smith, Richard E. Hippocampus pontohi Accessed 2012-10-31.
  11. ^ a b Weedy Pygmy Seahorse Accessed 2012-10-31.
  12. ^ Smith, Richard E. Hippocampus satomiae Accessed 2012-10-31.
  13. ^ Satomi's Pygmy Seahorse Accessed 2012-10-31.
  14. ^ Smith, Richard E. Hippocampus severnsi Accessed 2012-10-31.
  15. ^ Smith, Richard E. Hippocampus waleananus Accessed 2012-10-31.
  16. ^ Coleman's Pygmy Seahorse Accessed 2012-10-31.

This article incorporates text from the ARKive fact-file "Pygmy seahorse" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Tunjice Hills Seahorse

Tunjice Hills Seahorse can refer to any of the two fossil species of seahorse:


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!