Overview

Brief Summary

The genus Hippocampus is made up of 47 species of distinctive marine fish commonly known as the seahorses. They are found world-wide in protected, shallow tropical and temperate waters, especially estuaries, mangrove swamps, coral reefs, and eel grass beds. Seahorses do not have scales, instead have bony plates for protection, and swim slowly in an upright posture. They spend much of their time stationary, using their tails to attach themselves to corals, grasses, or other objects. They are ambush predators and feed on small crustaceans and other invertebrates.

Fossil and molecular dating evidence indicate that sea horses diverged from their closest relatives, the pipefish, in the Oligocene, about 13 million years ago.

Sea horses are well-known for their paternal care. After several days of courting, the female seahorse oviposits somewhere between a dozen and a thousand eggs into the male’s egg pouch, which is located on his pouch. The male regulates the water salinity in the pouch and incubates the eggs for 1-6 weeks, depending on the species. After the fry (typically 100-200, but this varies by species) emerge, he no longer provides any more care. Sea horses often form monogamous pairs for the breeding season, but many species trade partners readily and do not pair for life.

Sea horses are found in the aquarium trade, however they are difficult to keep. They can be bred in captivity, but tend to be cheaper when harvested from the wild. Sea horses are collected and used as aphrodisiacs and cures for respiratory ailments in traditional Chinese medicinal purposes; between collecting and destruction of environments, some are thought to be declining in numbers. CITES set up a set of trade recommendations with guidelines for international trade of all sea horse species in 2004.

A basal seahorse clade, now comprised of six species, contains the pygmy seahorses, which are less than 15 mm tall. Because of their small size, camouflage and commensurate living habits with colonial hydrozoans and coralline algae these species have been noticed and classified only since 1997.

(International Workshop on CITES Implementation for Seahorse Conservation and Trade 2004; Turner 2005; US Fish and Wildlife Service Office of Law Enforcement, 2004; Wikipedia 2012)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The genus Hippocampus is comprised of seahorses, bony fishes with equine profiles that swim upright. There are nearly 50 species of seahorses and they are mainly found in shallow tropical and temperate waters throughout the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 701 specimens in 41 taxa.
Water temperature and chemistry ranges based on 308 samples.

Environmental ranges
  Depth range (m): 0 - 2543
  Temperature range (°C): 3.048 - 28.408
  Nitrate (umol/L): 0.054 - 27.458
  Salinity (PPS): 32.507 - 37.543
  Oxygen (ml/l): 1.101 - 6.494
  Phosphate (umol/l): 0.072 - 2.067
  Silicate (umol/l): 0.756 - 22.128

Graphical representation

Depth range (m): 0 - 2543

Temperature range (°C): 3.048 - 28.408

Nitrate (umol/L): 0.054 - 27.458

Salinity (PPS): 32.507 - 37.543

Oxygen (ml/l): 1.101 - 6.494

Phosphate (umol/l): 0.072 - 2.067

Silicate (umol/l): 0.756 - 22.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus SL sp. A

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTATATTTAGTGTTTGGTGCTTGAGCTGGTATAGTAGGAACTGCCCTCAGTTTACTCATCCGAGCTGAATTAAGTCAACCGGGAGCTTTACTAGGTGATGATCAAATCTATAATGTTATTGTAACTGCTCATGCTTTCGTAATGATTTTTTTTATAGTCATACCTATTATAATTGGAGGTTTTGGTAACTGATTAATTCCTTTAATAATTGGAGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTACTGCCTCCTTCTTTCCTTCTCCTTTTAGCTTCATCAGGTGTAGAAGCTGGGGCAGGTACAGGTTGAACTGTTTATCCTCCATTAGCTGGGAATTTAGCTCATGCTGGTGCATCTGTTGATTTAACAATTTTTTCTCTTCATTTAGCAGGTGTATCCTCAATTCTAGGAGCTATTAATTTCATTACAACTATTATTAATATAAAACCTCCTTCTATTTCACAATATCAAACACCTTTATTTGTATGAGCAGTTCTAGTAACTGCTGTATTATTATTATTATCACTCCCTGTTTTAGCAGCTGGTATTACTATACTTTTAACCGATCGGAATTTAAATACAACATTTTTTGACCCTTCCGGAGGGGGAGACCCTATCTTATATCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus SL sp. A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. fuscus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATTCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCACCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGCAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATTAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGGGCAGTTTTAGTAACCGCAGTTCTACTTTTACTGTCATTACCTGTACTAGCAGCCGGGATCACTATGCTTCTTACAGACCGAAACTTAAACACAACATTCTTTGACCCTTCCGGAGGGGGAGATCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. fuscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. borboniensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATTCGGGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCACCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGCAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATTAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGGGCAGTTTTAGTAACCGCAGTTCTACTTTTACTGTCATTACCTGTACTAGCAGCCGGGATCACTATGCTTCTTACAGACCGAAACTTAAACACAACATTCTTTGACCCTTCCGGAGGGGGAGATCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. borboniensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hippocampus cf. barbouri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTATTAATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTGGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTTGTAATAATTTTTTTTATGGTAATACCAATTATGATTGGGGGTTTTGGTAATTGATTAGTTCCTTTAATAATCGGAGCGCCTGATATAGCCTTCCCTCGGATAAACAATATGAGTTTTTGATTATTACCACCTTCTTTCCTCCTTCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGAACTGTCTACCCCCCATTAGCAGGCAACCTAGCACATGCTGGAGCTTCAGTGGACTTAACAATTTTCTCCCTCCATTTAGCAGGTGTTTCGTCAATCCTCGGAGCTATTAACTTTATTACTACTATTATTAATATAAAACCCCCATCAATCTCACAATATCAAACACCACTGTTTGTATGAGCAGTTTTAGTAACTGCAGTTCTACTCTTACTATCCCTACCTGTATTAGCAGCTGGTATTACTATGCTTTTAACAGATCGGAATTTAAATACAACATTCTTTGACCCTTCTGGAGGAGGAGATCCTATCCTTTATCAGCATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus cf. barbouri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 215
Specimens with Sequences: 184
Specimens with Barcodes: 184
Species: 40
Species With Barcodes: 34
Public Records: 142
Public Species: 28
Public BINs: 26
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Seahorse

This article is about the genus of fish. For the mythological sea-horse, see hippocamp. For other uses, see seahorse (disambiguation).

Seahorse is the name given to 54 species of marine fishes in the genus Hippocampus. "Hippocampus" comes from the Ancient Greek hippos meaning "horse" and kampos meaning "sea monster".[2]

Habitat[edit]

Seahorses are mainly found in shallow tropical and temperate waters throughout the world, and live in sheltered areas such as seagrass beds, estuaries, coral reefs, or mangroves. Four species are found in Pacific waters from North America to South America. In the Atlantic, H. erectus ranges from Nova Scotia to Uruguay. H. zosterae, known as the dwarf seahorse, is found in the Bahamas.

Colonies have been found in European waters such as the Thames Estuary.[3]

Three species live in the Mediterranean Sea: H. guttulatus (the long-snouted seahorse), H. hippocampus (the short-snouted seahorse), and H. fuscus (the sea pony). These species form territories; males stay within 1 m2 (11 sq ft) of habitat, while females range about one hundred times that.

Physical description[edit]

Spiny seahorse H. histrix from East Timor holding on to soft coral with its prehensile tail

Seahorses range in size from 1.5 to 35.5 cm (0.6 to 14.0 in).[4] They are named for their equine appearance. Although they are bony fish, they do not have scales, but rather thin skin stretched over a series of bony plates, which are arranged in rings throughout their bodies. Each species has a distinct number of rings. Seahorses swim upright, another characteristic not shared by their close pipefish relatives, which swim horizontally. Razorfish are the only other fish that swim vertically like a seahorse. Unusual among fish, a seahorse has a flexible, well-defined neck. It also sports a coronet on its head, which is distinct for each individual.

Seahorses swim very poorly, rapidly fluttering a dorsal fin and using pectoral fins (located behind their eyes) to steer. The slowest-moving fish in the world is H. zosterae (the dwarf seahorse), with a top speed of about 5 ft (1.5 m) per hour.[5] Seahorses have no caudal fin. Since they are poor swimmers, they are most likely to be found resting with their prehensile tails wound around a stationary object. They have long snouts, which they use to suck up food, and their eyes can move independently of each other (like those of a chameleon).

Evolution and fossil record[edit]

Anatomical evidence, supported by molecular, physical, and genetic evidence, demonstrates seahorses are highly modified pipefish. The fossil record of seahorses, however, is very sparse. The best known and best studied fossils are specimens of H. guttulatus (though literature more commonly refers to them under the synonym of H. ramulosus), from the Marecchia River Formation of Rimini Province, Italy], dating back to the Lower Pliocene, about 3 million years ago. The earliest known seahorse fossils are of two pipefish-like species, H. sarmaticus and H. slovenicus from the coprolitic horizon of Tunjice Hills, a middle Miocene lagerstätte in Slovenia dating back about 13 million years.[6] Molecular dating finds that pipefish and seahorses diverged during the Late Oligocene. This has led to speculation that seahorses evolved in response to large areas of shallow water, newly created as the result of tectonic events. The shallow water would have allowed the expansion of seagrass habitats that selected for the camouflage offered by the seahorses’ upright posture.[7] These tectonic changes occurred in the western Pacific Ocean, pointing to an origin there, with molecular data suggesting two later, separate invasions of the Atlantic Ocean.[8]

Reproduction[edit]

1. Seahorses court: after the hours-to-days-long process, the female transfers her eggs to the egg pouch of the male, located on his abdomen. 2. The fertilized eggs grow and develop into baby seahorses inside the egg pouch of the male. 3. From his pouch, the male ejects the baby seahorses, which number from five to 2,500 young at a time, but average 100–1000. 4. The seahorses grow and develop to maturity, and the cycle begins again.

The male seahorse is equipped with a pouch on the ventral, or front-facing, side of the tail. When mating, the female seahorse deposits up to 1,500 eggs in the male's pouch. The male carries the eggs for 9 to 45 days until the seahorses emerge fully developed, but very small. Once the young are released into the water, the male's role is done and he offers no further care and often mates again within hours or days during the breeding season.[9]

Courtship[edit]

Before breeding, seahorses may court for several days. Scientists believe the courtship behavior synchronizes the animals' movements and reproductive states so the male can receive the eggs when the female is ready to deposit them. During this time, they may change color, swim side by side holding tails or grip the same strand of sea grass with their tails, and wheel around in unison in what is known as a "predawn dance". They eventually engage in a "true courtship dance" lasting about 8 h, during which the male pumps water through the egg pouch on his trunk which expands and opens to display its emptiness. When the female’s eggs reach maturity, she and her mate let go of any anchors and drift upward snout-to-snout, out of the seagrass, often spiraling as they rise. The female inserts her ovipositor into the male’s brood pouch and deposits dozens to thousands of eggs. As the female releases her eggs, her body slims while his swells. Both animals then sink back into the seagrass and she swims away.

Gestation[edit]

Pregnant seahorse at the New York Aquarium

The male releases his sperm directly into seawater,.[10] where it fertilizes the eggs,[11] which are then embedded in the pouch wall and become surrounded by a spongy tissue.[12] The male supplies the eggs with prolactin, the same hormone responsible for milk production in pregnant mammals. The pouch provides oxygen, as well as a controlled environment incubator. The eggs then hatch in the pouch, where the salinity of the water is regulated; this prepares the newborns for life in the sea.[13][14][15] Throughout gestation, which in most species requires two to four weeks, his mate visits him daily for “morning greetings”. They interact for about 6 min, reminiscent of courtship. The female then swims away until the next morning, and the male returns to sucking up food through his snout.[13]

Birth[edit]

The number of young released by the male seahorse averages 100–1000 for most species, but may be as low as 5 for the smaller species, or as high as 2,500. When the fry are ready to be born, the male expels them with muscular contractions. He typically gives birth at night and is ready for the next batch of eggs by morning when his mate returns. Like almost all other fish species, seahorses do not nurture their young after birth. Infants are susceptible to predators or ocean currents which wash them away from feeding grounds or into temperatures too extreme for their delicate bodies. Less than 0.5% of infants survive to adulthood, explaining why litters are so large. These survival rates are actually fairly high compared to other fish, because of their protected gestation, making the process worth the great cost to the father. The eggs of most other fish are abandoned immediately after fertilization.[15]

Questions surrounding reproductive roles[edit]

Reproduction is energetically costly to the male. This brings into question why the sexual role reversal even takes place. In an environment where one partner incurs more energy costs than the other, Bateman's principle suggests that the lesser contributor takes the role of the aggressor. Male seahorses are more aggressive and sometimes “fight” for female attention. According to Amanda Vincent of Project Seahorse, only males tail-wrestle and snap their heads at each other. This discovery prompted further study of energy costs. To estimate the female’s direct contribution, researcher Heather D. Masonjones, associate professor of biology at the University of Tampa, chemically analyzed the energy stored in each egg. To measure the burden on the male, Masonjones measured its oxygen consumption. By the end of incubation, the male consumed almost 33% more oxygen than before mating. The study concluded that the female's energy expenditure while generating eggs is twice that of males during incubation[13] confirming the standard hypothesis.

Why the male seahorse (and other members of the Syngnathidae) carries the offspring through gestation is unknown, though some researchers [16] believe it allows for shorter birthing intervals, in turn resulting in more offspring. Given an unlimited number of ready and willing partners, males have the potential to produce 17% more offspring than females in a breeding season. Also, females have “time-outs” from the reproductive cycle 1.2 times longer than those of males. This seems to be based on mate choice, rather than physiology. When the female’s eggs are ready, she must lay them in a few hours or eject them into the water column. Making eggs is a huge cost to her physically, since they amount to about a third of her body weight. To protect against losing a clutch, the female demands a long courtship. The daily greetings help to cement the bond between the pair.[17]

Monogamy[edit]

One common misconception about seahorses is that they mate for life. Many species of seahorses form pair bonds that last through at least the breeding season. Some species show a higher level of mate fidelity than others.[18][19] However, many species readily switch mates when the opportunity arises. H. abdominalis and H. breviceps have been shown to breed in groups, showing no continuous mate preference. Many more species' mating habits have not been studied, so it is unknown how many species are actually monogamous, or how long those bonds actually last.[20]

Although monogamy within fish is not common, it does appear to exist for some. In this case, the mate-guarding hypothesis may be an explanation. This hypothesis states, “males remain with a single female because of ecological factors that make male parental care and protection of offspring especially advantageous.”[21] Because the rates of survival for newborn seahorses are so low, incubation is essential. Though not proven, males could have taken on this role because of the lengthy period the females require to produce their eggs. If males incubate while females prepare the next clutch (amounting to a third of body weight), they can reduce the interval between clutches.

Feeding habits[edit]

Seahorses feed on small crustaceans floating in the water or crawling on the bottom. With excellent camouflage and patience, seahorses ambush prey that floats within striking range. Mysid shrimp and other small crustaceans are favorites, but some seahorses have been observed eating other kinds of invertebrates and even larval fish. While feeding, they produce a distinctive click each time a food item is ingested. The same clicks are heard with social interactions. In a study of seahorses, the distinctive head shape was found to give rise to a space that is met with minimal interference. Therefore, the seahorse has the ability to come within a very close range of copepods, on which they prey.[22][23]

Threats of extinction[edit]

Seahorse and scorpion skewers as street food

Because data is lacking on the sizes of the various seahorse populations, as well as other issues including how many seahorses are dying each year, how many are being born, and the number used for souvenirs, there is insufficient information to assess their risk of extinction, and the risk of losing more seahorses remains a concern. Some species, such as the Paradoxical Seahorse, H. paradoxus,[24] may already be extinct. Coral reefs and seagrass beds are deteriorating, reducing viable habitats for seahorses.[25]

Aquaria[edit]

While many aquarium hobbyists keep them as pets, seahorses collected from the wild tend to fare poorly in home aquaria. Many eat only live foods such as brine shrimp and are prone to stress, which damages their immune systems and makes them susceptible to disease.

In recent years, however, captive breeding has become more popular. Such seahorses survive better in captivity, and are less likely to carry diseases. They eat frozen mysidacea (crustaceans) that are readily available from aquarium stores,[26] and do not experience the stress of moving out of the wild. Although captive-bred seahorses are more expensive, they take no toll on wild populations.

Seahorses should be kept in an aquarium with low flow and placid tank mates. They are slow feeders, so fast, aggressive feeders will leave them without food.[26] Seahorses can coexist with many species of shrimp and other bottom-feeding creatures. Gobies also make good tank-mates. Keepers are generally advised to avoid eels, tangs, triggerfish, squid, octopus, and sea anemones.[27]

Water quality is very important for the survival of seahorses in an aquarium. They are delicate species which should not be added to a new tank. The water parameters are recommended to be as follows although these fish may acclimatise to different water over time: Temperature: 23–28°C pH: 8.1–8.4 Ammonia: 0 mg/l (0.01 mg/l may be tolerated for short periods) Nitrite: 0 mg/l (0.125 mg/l may be tolerated for short periods) S.G.: 1.021–1.024 at 22–24°C A water-quality problem will affect fish behaviour and can be shown by clamped fins, reduced feeding, erratic swimming, and gasping at the surface.[28] Seahorses swim up and down, as well as using the length of the aquarium. Therefore, the tanks should ideally be twice as deep as the length of the adult seahorse.

Animals sold as "freshwater seahorses" are usually the closely related pipefish, of which a few species live in the lower reaches of rivers. The supposed true "freshwater seahorse" called H. aimei is not a valid species, but a synonym sometimes used for Barbour's and hedgehog seahorses. The latter, which is often confused with the former, can be found in estuarine environments, but is not actually a freshwater fish.[29]

Use in Chinese medicine[edit]

Dried seahorse

Seahorse populations are thought to be endangered as a result of overfishing and habitat destruction. Despite a lack of scientific studies or clinical trial,[30][31] the consumption of seahorses for medicinal purposes is widespread in China, where they are used in traditional Chinese medicine primarily for the treatment of impotence, wheezing, nocturnal enuresis, and pain, as well as to promote labor.[32] Up to 20 million seahorses may be caught each year to be sold for such uses.[33] Preferred species of seahorses include H. kellogii, H. histrix, H. kuda, H. trimaculatus, and H. mohnikei.[32] Seahorses are also consumed by the Indonesians, the central Filipinos, and many other ethnic groups.

Import and export of seahorses has been controlled under CITES since 15 May 2004. However, Indonesia, Japan, Norway, and South Korea have chosen to opt out of the trade rules set by CITES.

The problem may be exacerbated by the growth of pills and capsules as the preferred method of ingesting seahorses. Pills are cheaper and more available than traditional, individually tailored prescriptions of whole seahorses, but the contents are harder to track. Seahorses once had to be of a certain size and quality before they were accepted by TCM practitioners and consumers. Declining availability of the preferred large, pale, and smooth seahorses has been offset by the shift towards prepackaged preparations, which makes it possible for TCM merchants to sell previously unused, or otherwise undesirable juvenile, spiny, and dark-coloured animals. Today, almost a third of the seahorses sold in China are packaged, adding to the pressure on the species.[34]

Dried seahorse retails from US$600 to $3000 per kilogram, with larger, paler, and smoother animals commanding the highest prices. In fact, in terms of value based on weight, seahorses retail for more than the price of silver and almost that of gold in Asia.[35]

Species[edit]

The 54 currently recognized species in this genus are:[36]

H. kuda, known as the "common seahorse"
H. subelongatus, known as the "West Australian seahorse"
H. whitei, known as "White's seahorse"
Hippocampus satomiae (Satomi's pygmy seahorse) attached to coral

Pygmy seahorses[edit]

Main article: Hippocampinae

Pygmy seahorses are less than 15 millimeters (0.59 in) tall and 17 millimeters (0.67 in) wide members of the genus. Previously the term was applied exclusively to the species H. bargibanti but since 1997, discoveries have made this term obsolete. The species H. minotaur, H. denise, H. colemani, H. pontohi, H. severnsi and H. satomiae have been described. Other species that are believed to be unclassified have also been reported in books, dive magazines and on the Internet. They can be distinguished from other species of seahorse by their 12 trunk rings, low number of tail rings (26–29), the location in which young are brooded in the trunk region of males and their extremely small size.[37] Molecular analysis (of ribosomal RNA) of 32 Hippocampus species found that H. bargibanti belongs in a separate clade from other members of the genus and therefore that the species diverged from the other species in the "ancient" past.[38]

Most pygmy seahorses are well camouflaged and live in close association with other organisms including colonial hydrozoans (Lytocarpus and Antennellopsis), coralline algae (Halimeda) sea fans (Muricella, Annella, Acanthogorgia). This combined with their small size accounts for why most species have only been noticed and classified since 2001.[37][39]

References[edit]

  1. ^ Hippocampus Rafinesque, 1810, WoRMS
  2. ^ Duvernoy, HM (2005). "Introduction". The Human Hippocampus (3rd ed.). Berlin: Springer-Verlag. p. 1. ISBN 3-540-23191-9. 
  3. ^ "Rare seahorses breeding in Thames". BBC News. 7 April 2008. Retrieved 11 November 2009. 
  4. ^ "Seahorses, Seahorse Pictures, Seahorse Facts". National Geographic. Retrieved 17 May 2012. 
  5. ^ Guinness Book of World Records (2009)
  6. ^ Žalohar J., Hitij T., Križnar M. (2009). "Two new species of seahorses (Syngnathidae, Hippocampus) from the Middle Miocene (Sarmatian) Coprolitic Horizon in Tunjice Hills, Slovenia: The oldest fossil record of seahorses". Annales de Paléontologie 95 (2): 71–96. doi:10.1016/j.annpal.2009.03.002. 
  7. ^ Teske PR, Beheregaray LB (2009). "Evolution of seahorses' upright posture was linked to Oligocene expansion of seagrass habitats". Biol Lett. 5 (4): 521–3. doi:10.1098/rsbl.2009.0152. PMC 2781918. PMID 19451164. 
  8. ^ Teske PR, Cherry MI, Matthee CA (2004). "The evolutionary history of seahorses (Syngnathidae: Hippocampus): molecular data suggest a West Pacific origin and two invasions of the Atlantic Ocean". Mol Phylogenet Evol. 30 (2): 273–86. doi:10.1016/S1055-7903(03)00214-8. PMID 14715220. 
  9. ^ Foster S.J, Vincent C.J. (2004). "Life history and ecology of seahorses: implications for conservation and management". Journal of Fish Biology 65: 1–61. doi:10.1111/j.1095-8649.2004.00429.x. 
  10. ^ Connor, Steve (19 January 2007). "Sex and the seahorse". London: The Independent. Retrieved 11 November 2009. 
  11. ^ Connor, Steve (19 January 2007) Sex and the seahorse. independent.co.uk
  12. ^ "The biology of seahorses: Reproduction". The Seahorse Project. Archived from the original on 3 March 2009. Retrieved 8 May 2007. 
  13. ^ a b c Milius, S. (2000). "Pregnant: And Still Macho". Science News 157 (11): 168. doi:10.2307/4012130. JSTOR 4012130.  edit
  14. ^ Masonjones, H. D.; Lewis, S. M. (2000). "Differences in potential reproductive rates of male and female seahorses related to courtship roles". Animal Behaviour 59 (1): 11–20. doi:10.1006/anbe.1999.1269. PMID 10640362.  edit
  15. ^ a b Danielson, Stentor (14 June 2002). "Seahorse Fathers Take Reins in Childbirth". National Geographic News. 
  16. ^ Vincent, Amanda C. J. (1994). "Operational Sex Ratios in Seahorses". Behaviour 128 (1/2): 153–167. doi:10.1163/156853994X00091. JSTOR 4535169. 
  17. ^ "Why Do Male Seahorses Get Pregnant?". Petseahorse.com. 
  18. ^ Kvarnemo C, Moore G.I, Jones A.G, Nelson W.S, Avise J.C. (2000). "Monogamous pair bonds and mate switching in the Western Australian seahorse Hippocampus subelongatus". J. Evol. Biol. 13 (6): 882–8. doi:10.1046/j.1420-9101.2000.00228.x. 
  19. ^ Vincent C.J., Sadler L.M. (1995). "Faithful pair bonds in wild seahorses, Hippocampus whitei". Anim. Behav. 50 (6): 1557–1569. doi:10.1016/0003-3472(95)80011-5. Archived from the original on 23 July 2011. 
  20. ^ Weiss, Tami (10 April 2010). "What’s Love Got to Do With It? The Truth About Seahorse Monogamy". fusedjaw.com. 
  21. ^ Alcock, John (2005). Animal Behavior (8th ed.). Massachusetts: Sinauer. pp. 370–1. ISBN 0878930051. 
  22. ^ Langley, Liz (26 November 2013). "Why Does the Seahorse Have Its Odd Head? Mystery Solved – News Watch". Newswatch.nationalgeographic.com. 
  23. ^ Gemmell, B. J.; Sheng, J.; Buskey, E. J. (2013). "Morphology of seahorse head hydrodynamically aids in capture of evasive prey". Nature Communications 4. doi:10.1038/ncomms3840.  edit
  24. ^ "New species of seahorse found... after sitting in a museum for more than a decade". Daily Mail. <!- – 09:04 EST --> 17 February 2011. Retrieved 4 April 2014. 
  25. ^ Lourie, Sarah A.; Foster, Sarah J.; Cooper, Ernest W.T. and Vincent, Amanda C.J. (2004) A Guide to the Identification of Seahorses. Project Seahorse Advancing Marine Conservation, ISBN 0-89164-169-6.
  26. ^ a b "Seahorse and Pipefish Foods | Tami Weiss". Fusedjaw.com. 25 June 2005. Retrieved 11 November 2009. 
  27. ^ "Seahorse Tankmates | Will Wooten". Fusedjaw.com. 25 June 2004. Retrieved 11 November 2009. 
  28. ^ How to care for Seahorses & Pipefish. seahorseaquariums.ie
  29. ^ "Hippocampus spinosissimus". Fishbase. Retrieved 11 November 2009. 
  30. ^ Stephen Barrett, M.D. "Be Wary of Acupuncture, Qigong, and "Chinese Medicine"". Retrieved 11 December 2013. 
  31. ^ Still, J. (2003). "Use of animal products in traditional Chinese medicine: Environmental impact and health hazards". Complementary Therapies in Medicine 11 (2): 118–22. doi:10.1016/S0965-2299(03)00055-4. PMID 12801499.  edit
  32. ^ a b Bensky, D., Clavey, S., Stoger, E. (2004) Chinese Herbal Medicine: Materia Medica. Eastland Press, Inc. Seattle, 3rd ed. ISBN 0939616424. p. 815
  33. ^ "Seahorse Crusader Amanda Vincent" on Nova television show
  34. ^ Parry-Jones, Rob and Vincent, Amanda (3 January 1998). "Can we tame wild medicine?". New Scientist. 
  35. ^ "Save Our Seahorses". Save Our Seahorses. Retrieved 13 May 2014. 
  36. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Hippocampus in FishBase. October 2012 version.
  37. ^ a b Lourie, Sara; Rudie Kuiter (2008). "Three new pygmy seahorse species from Indonesia (Teleostei: Syngnathidae: Hippocampus)". Zootaxa 1963: 54–68. ISSN 1175-5334. Retrieved 9 June 2009. 
  38. ^ Teske, Peter; Michael Cherry and Conrad Matthee (February 2004). "The evolutionary history of seahorses (Syngnathidae: Hippocampus): molecular data suggest a West Pacific origin and two invasions of the Atlantic Ocean". Molecular Phylogenetics and Evolution 30 (2): 273–286. doi:10.1016/S1055-7903(03)00214-8. PMID 14715220. 
  39. ^ "Science in Pictures: Pygmy Seahorses." The Epoch Times, Northern California Edition (8 November 2011).

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy seahorse

The pygmy seahorses comprise several species of tiny seahorse in the syngnathid family or Syngnathidae (seahorses and pipefish). Family Syngnathidae is part of order Syngnathiformes, which contains fishes with fused jaws that suck food into tubular mouths. They are found in Southeast Asia in the Coral Triangle area. They are some of the smallest seahorse species in the world, typically measuring less than 2 centimetres (0.79 in) in height.[1][2]

The first pygmy seahorse known to science was Hippocampus bargibanti. At least six more species were named after 2000. The first species discovered lives exclusively on fan corals and matches their colour and appearance. So effective is pygmy seahorse camouflage that it was discovered only when a host gorgonian was being examined in a laboratory. Other species live on soft corals or are free-ranging among seagrasses and algae.[3]

Description[edit]

The pygmy seahorse is both tiny and well camouflaged. It is very difficult to spot amongst the sea grasses, soft corals, or gorgonians (sea fans) that it inhabits. Other distinctive pygmy seahorse characteristics include a fleshy head and body, a very short snout, and a long, prehensile tail. With their short snouts, they have the appearance of baby animals. Pygmy seahorses are 14–27 millimetres (0.55–1.06 in) long from the tip of the tail to the end of the snout, so that their vertical height while swimming is still smaller.[4] An adult may be as small as 13 millimetres (0.51 in) long.[5]

True pygmy seahorses have distinctive morphological markers.[4]

  • Unlike other seahorses, they have a single gill opening on the back of the head, instead of two on the sides.
  • Males brood their young inside their trunk, instead of in a pouch on the tail.

Males and females are distinguished by openings at the bottom of the trunk: females have a tiny, raised round pore for extruding eggs and males have a fore-and-aft slit for accepting them.[4]

Species[edit]

Well-camouflaged pygmy seahorse on a gorgonian coral Muricella sp. See this image to identify the pygmy seahorse.
A pygmy seahorse found at a depth of around 32 metres (105 ft) at Tulamben near a shipwreck
Pygmy seahorse found while diving Nudi's Fall, Lembeh, Indonesia

The known species are these:

  • Denise's pygmy seahorse (Hippocampus denise) was described in 2003. Its range is from Borneo to New Guinea, Solomon Islands and Palau. They must live on gorgonian corals but have been found on eight different genera: Acanthogorgia, Annella, Echinogorgia, Ellisella, Melithaea, Muricella, Verrucella and Villogorgia. Each pygmy seahorse stays on the same coral for its entire adult life. The young settle onto a host and over a few days take on its exact colour and texture, accounting for the wide variation in adults, but typically red, orange, or yellow. They grow up to 2.4 cm long.[8] They have smooth skin with few tubercles. They have a bent, asymmetrical appearance. Females have a slender body with a small bulge at the base of the trunk, while males are rounder. They are found at depths of 13–90m. Underwater photographer Denise Tackett noticed that they were different from H. bargibanti and brought them to the attention of scientists.[9]
  • Pontoh's pygmy seahorse (Hippocampus pontohi) was named in 2008. This species is free-living, not associated with gorgonian corals, and tends to live in shallower water (3m - 20m). They are found in the Coral Triangle area: Indonesia, Papua New Guinea, Solomon Islands and Fiji. They can be found anywhere on tropical reefs in their range. However, they are most often seen in pairs or small groups in clumps of the calcareous alga, Halimeda[10] and on the hydroid Aglaephenia cupressina. They are often found where Halimeda grows out of reef walls. Divers report them on many types of seagrass and algae, moving frequently to different hitching spots.[11] They are almost identical in shape to the Severn's pygmy seahorse, but are a different colour: white with pink or yellow patches.[10] They lack tubercules. The trunk is round but thin when viewed from behind. They are seen in high-current areas at depths of 11-25m.[11]
  • Satomi's pygmy seahorse (Hippocampus satomiae), named in 2008, are the world's smallest seahorse at up to 1.4 cm. This is a free-living species that is found near coral walls with soft corals. They are nocturnal and very active at night. They have been found in only a few places in Indonesia and northern Borneo. They can be brown to pale with specific markings such as a dark spot in front of each relatively large eye.[12] Spines cover the entire body. Both males and females have a round trunk. They are found from 15 – 20 meters deep in groups of 3 to 5.[13]
  • Severn's pygmy seahorse (Hippocampus severnsi) is a free-living species described in 2008. They are almost the same shape as Pontoh's pygmy seahorse, but are a different colour: pale brown with red and orange patches. They can be found on any part of the reef, but often on hydroids and algal turf in pairs or small group. They are no larger than 1.7 cm.[14]
  • Walea soft coral pygmy seahorse (Hippocampus waleananus) lives on and around soft coral. The soft coral have fat stems and this seahorse has a correspondingly long tail. They vary from pale pink to yellow. It has a very small range: it lives only in the Tomini Gulf of central Sulawesi, Indonesia, and depends on the continued existence of soft corals there.[15]
  • Coleman's pygmy seahorse (Hippocampus colemani) is probably restricted to Lord Howe Island off the east coast of Australia. However, there are unconfirmed reports from eastern Papua New Guinea and Taiwan.[4] This pygmy seahorse was found in the lagoon of Lord Howe Island living on seagrass, mainly Zostera and Halophila. It was described in 2003. It is white, yellow, or gold with white spots outlined in red. It has a very small snout and well-defined nose spine. Both males and females are rotund.[16]
  • Japanese pygmy seahorse has been discovered but not officially described.[4]

Other dwarf species[edit]

Other small seahorses are sometimes called pygmy seahorses, but lack the single gill opening and trunk brooding that distinguish the true pygmy seahorse. They can be called dwarf seahorses:[4]

References[edit]

  1. ^ Lourie, S.A., Foster, S.J., Cooper, E.W.T. and Vincent, A.C.J. (2004) A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America, Washington D.C..
  2. ^ Bargibant's seahorse. Accessed 2012-11-02.
  3. ^ Reijnen, B.T., van der Meij, S.E.T., van Ofwegen, L.P. (2011) "Fish, fans and hydroids: host species of pygmy seahorses." ZooKeys 103: 1-26.
  4. ^ a b c d e f Smith, Richard E. Pygmy seahorse research
  5. ^ Fishes of Australia: H. bargibanti. Accessed 2012-11=02.
  6. ^ Smith, Richard E. Hippocampus bargibanti Accessed 2012-10-31.
  7. ^ Common Pygmy Seahorse Accessed 2012-10-31.
  8. ^ Smith, Richard E. Hippocampus denise Accessed 2012-10-31.
  9. ^ Denise's Pygmy Seahorse Accessed 2012-10-31.
  10. ^ a b Smith, Richard E. Hippocampus pontohi Accessed 2012-10-31.
  11. ^ a b Weedy Pygmy Seahorse Accessed 2012-10-31.
  12. ^ Smith, Richard E. Hippocampus satomiae Accessed 2012-10-31.
  13. ^ Satomi's Pygmy Seahorse Accessed 2012-10-31.
  14. ^ Smith, Richard E. Hippocampus severnsi Accessed 2012-10-31.
  15. ^ Smith, Richard E. Hippocampus waleananus Accessed 2012-10-31.
  16. ^ Coleman's Pygmy Seahorse Accessed 2012-10-31.

This article incorporates text from the ARKive fact-file "Pygmy seahorse" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Tunjice Hills Seahorse

Tunjice Hills Seahorse can refer to any of the two fossil species of seahorse:


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!