Ecology
Habitat
Depth range based on 13878 specimens in 9 taxa.
Water temperature and chemistry ranges based on 11080 samples.
Environmental ranges
Depth range (m): -9 - 515
Temperature range (°C): -2.072 - 24.160
Nitrate (umol/L): 0.338 - 32.084
Salinity (PPS): 6.114 - 36.463
Oxygen (ml/l): 3.066 - 8.393
Phosphate (umol/l): 0.141 - 2.853
Silicate (umol/l): 1.424 - 60.201
Graphical representation
Depth range (m): -9 - 515
Temperature range (°C): -2.072 - 24.160
Nitrate (umol/L): 0.338 - 32.084
Salinity (PPS): 6.114 - 36.463
Oxygen (ml/l): 3.066 - 8.393
Phosphate (umol/l): 0.141 - 2.853
Silicate (umol/l): 1.424 - 60.201
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 11080 samples.
Environmental ranges
Depth range (m): -9 - 515
Temperature range (°C): -2.072 - 24.160
Nitrate (umol/L): 0.338 - 32.084
Salinity (PPS): 6.114 - 36.463
Oxygen (ml/l): 3.066 - 8.393
Phosphate (umol/l): 0.141 - 2.853
Silicate (umol/l): 1.424 - 60.201
Graphical representation
Depth range (m): -9 - 515
Temperature range (°C): -2.072 - 24.160
Nitrate (umol/L): 0.338 - 32.084
Salinity (PPS): 6.114 - 36.463
Oxygen (ml/l): 3.066 - 8.393
Phosphate (umol/l): 0.141 - 2.853
Silicate (umol/l): 1.424 - 60.201
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Ammodytes cf. personatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTAGTATTTGGTGCTTGAGCCGCTATGGTGGGGACGGCTCTAAGCCTGCTCATCCGAGCAGAACTTAGCCAACCCGGCGCCCTCCTAGGAGATGATCAAATCTATAACGTAATTGTTACCGCTCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGACTAATCCCCCTAATGATTGGTGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTCCCACCCTCCCTCCTTCTTCTCCTAGCCTCTTCAGGCGTAGAAGCTGGAGCTGGTACCGGTTGAACTGTATACCCTCCCCTGGCCGGAAATCTAGCCCACGCAGGTGCATCTGTTGACTTAACAATCTTCTCTCTGCATTTAGCCGGGATCTCCTCGATTCTTGGAGCAATCAACTTCATCACCACAATTATTAACATGAAACCTCCCGCTATCTCTCAGTATCAGACACCCTTATTTGTGTGAGCTGTGCTGATTACAGCCGTCCTTCTCCTCCTCTCCCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGCAACTTAAATACCACCTTCTTTGACCCTGCAGGAGGGGGAGACCCCATTCTGTACCAACACCTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Ammodytes cf. personatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 156 | Public Records: | 67 |
| Specimens with Sequences: | 136 | Public Species: | 5 |
| Specimens with Barcodes: | 136 | Public BINs: | 5 |
| Species: | 8 | ||
| Species With Barcodes: | 8 | ||
Trusted
Barcode data
Trusted
Locations of barcode samples
Trusted
Wikipedia
Ammodytes
Ammodytes is a genus of sand lances native to the northern oceans.
Species
There are currently six recognized species in this genus:[1]
- Ammodytes americanus DeKay, 1842 (American sand lance)
- Ammodytes dubius J. C. H. Reinhardt, 1837 (Northern sand lance)
- Ammodytes hexapterus Pallas, 1814 (Pacific sand lance)
- Ammodytes marinus Raitt, 1934 (Lesser sand-eel)
- Ammodytes personatus Girard, 1856 (Pacific sandlance)
- Ammodytes tobianus Linnaeus, 1758 (Small sandeel)
References
- ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Ammodytes in FishBase. December 2012 version.
| This Perciformes article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

