Ecology

Habitat

Depth range based on 13878 specimens in 9 taxa.
Water temperature and chemistry ranges based on 11080 samples.

Environmental ranges
  Depth range (m): -9 - 515
  Temperature range (°C): -2.072 - 24.160
  Nitrate (umol/L): 0.338 - 32.084
  Salinity (PPS): 6.114 - 36.463
  Oxygen (ml/l): 3.066 - 8.393
  Phosphate (umol/l): 0.141 - 2.853
  Silicate (umol/l): 1.424 - 60.201

Graphical representation

Depth range (m): -9 - 515

Temperature range (°C): -2.072 - 24.160

Nitrate (umol/L): 0.338 - 32.084

Salinity (PPS): 6.114 - 36.463

Oxygen (ml/l): 3.066 - 8.393

Phosphate (umol/l): 0.141 - 2.853

Silicate (umol/l): 1.424 - 60.201
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ammodytes cf. personatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGCTATGGTGGGGACGGCTCTAAGCCTGCTCATCCGAGCAGAACTTAGCCAACCCGGCGCCCTCCTAGGAGATGATCAAATCTATAACGTAATTGTTACCGCTCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGACTAATCCCCCTAATGATTGGTGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTCCCACCCTCCCTCCTTCTTCTCCTAGCCTCTTCAGGCGTAGAAGCTGGAGCTGGTACCGGTTGAACTGTATACCCTCCCCTGGCCGGAAATCTAGCCCACGCAGGTGCATCTGTTGACTTAACAATCTTCTCTCTGCATTTAGCCGGGATCTCCTCGATTCTTGGAGCAATCAACTTCATCACCACAATTATTAACATGAAACCTCCCGCTATCTCTCAGTATCAGACACCCTTATTTGTGTGAGCTGTGCTGATTACAGCCGTCCTTCTCCTCCTCTCCCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGCAACTTAAATACCACCTTCTTTGACCCTGCAGGAGGGGGAGACCCCATTCTGTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ammodytes cf. personatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:156Public Records:67
Specimens with Sequences:136Public Species:5
Specimens with Barcodes:136Public BINs:5
Species:8         
Species With Barcodes:8         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Ammodytes

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ammodytes


Ammodytes is a genus of sand lances native to the northern oceans.

Species

There are currently six recognized species in this genus:[1]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Ammodytes in FishBase. December 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!