Overview
Brief Summary
Diaphus is a genus of lanternfish, a mesopelagic fish known for its use of bioluminescence.
Unreviewed
Ecology
Habitat
Depth range based on 3234 specimens in 78 taxa.
Water temperature and chemistry ranges based on 2626 samples.
Environmental ranges
Depth range (m): 0 - 50000
Temperature range (°C): 1.384 - 28.020
Nitrate (umol/L): 0.122 - 44.812
Salinity (PPS): 31.271 - 40.379
Oxygen (ml/l): 0.108 - 7.761
Phosphate (umol/l): 0.025 - 3.281
Silicate (umol/l): 0.774 - 175.223
Graphical representation
Depth range (m): 0 - 50000
Temperature range (°C): 1.384 - 28.020
Nitrate (umol/L): 0.122 - 44.812
Salinity (PPS): 31.271 - 40.379
Oxygen (ml/l): 0.108 - 7.761
Phosphate (umol/l): 0.025 - 3.281
Silicate (umol/l): 0.774 - 175.223
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2626 samples.
Environmental ranges
Depth range (m): 0 - 50000
Temperature range (°C): 1.384 - 28.020
Nitrate (umol/L): 0.122 - 44.812
Salinity (PPS): 31.271 - 40.379
Oxygen (ml/l): 0.108 - 7.761
Phosphate (umol/l): 0.025 - 3.281
Silicate (umol/l): 0.774 - 175.223
Graphical representation
Depth range (m): 0 - 50000
Temperature range (°C): 1.384 - 28.020
Nitrate (umol/L): 0.122 - 44.812
Salinity (PPS): 31.271 - 40.379
Oxygen (ml/l): 0.108 - 7.761
Phosphate (umol/l): 0.025 - 3.281
Silicate (umol/l): 0.774 - 175.223
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Diaphus cf. thiollierei
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
GCGCCCTCCTGGGGGATGACCAGATTTACAACGTAATCGTAACAGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATTATGATTGGGGGCTTTGGAAANTGACTAATTCCCCTTATGATCGGTGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCCTTCCTTCTCCTATTGGCCTCATCTGGTGTAGAAGCTGGGGCTGGGACCGGATGAACAGTCTACCCGCCTCTTGCAGGCAACCTCGCTCACGCCGGGGCCTCTGTCGATCTGACAATTTTCTCCCTCCACCTGGCAGGTGTCTCCTCCATTTTAGGAGCAATCAACTTCATCACAACCATCATCAACATAAAACCCCCTGCGATCACTCAATACCAAACCCCTCTGTTCGTATGGGCAGTCCTTATTACAGCCGTGCTTCTTCTTCTCTCCCTCCCCGTCCTAGCCGCTGGCATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCTGCAGGAGGGGGAGACCCTATTCTTTACCAACACCTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Diaphus cf. thiollierei
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Locations of barcode samples
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 340 | Public Records: | 21 |
| Specimens with Sequences: | 277 | Public Species: | 7 |
| Specimens with Barcodes: | 275 | Public BINs: | 9 |
| Species: | 38 | ||
| Species With Barcodes: | 34 | ||
Trusted
Barcode data
Trusted
Wikipedia
Diaphus
Diaphus is a genus of lanternfishes.
Species
There are currently 78 recognized species in this genus: [2]
References
- ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. http://strata.ummp.lsa.umich.edu/jack/showgenera.php?taxon=611&rank=class. Retrieved 2007-12-25.
- ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Diaphus in FishBase. April 2012 version.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


