Overview

Brief Summary

Diaphus is a genus of lanternfish, a mesopelagic fish known for its use of bioluminescence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3234 specimens in 78 taxa.
Water temperature and chemistry ranges based on 2626 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): 1.384 - 28.020
  Nitrate (umol/L): 0.122 - 44.812
  Salinity (PPS): 31.271 - 40.379
  Oxygen (ml/l): 0.108 - 7.761
  Phosphate (umol/l): 0.025 - 3.281
  Silicate (umol/l): 0.774 - 175.223

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): 1.384 - 28.020

Nitrate (umol/L): 0.122 - 44.812

Salinity (PPS): 31.271 - 40.379

Oxygen (ml/l): 0.108 - 7.761

Phosphate (umol/l): 0.025 - 3.281

Silicate (umol/l): 0.774 - 175.223
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diaphus cf. thiollierei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCGCCCTCCTGGGGGATGACCAGATTTACAACGTAATCGTAACAGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATTATGATTGGGGGCTTTGGAAANTGACTAATTCCCCTTATGATCGGTGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCCTTCCTTCTCCTATTGGCCTCATCTGGTGTAGAAGCTGGGGCTGGGACCGGATGAACAGTCTACCCGCCTCTTGCAGGCAACCTCGCTCACGCCGGGGCCTCTGTCGATCTGACAATTTTCTCCCTCCACCTGGCAGGTGTCTCCTCCATTTTAGGAGCAATCAACTTCATCACAACCATCATCAACATAAAACCCCCTGCGATCACTCAATACCAAACCCCTCTGTTCGTATGGGCAGTCCTTATTACAGCCGTGCTTCTTCTTCTCTCCCTCCCCGTCCTAGCCGCTGGCATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCTGCAGGAGGGGGAGACCCTATTCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diaphus cf. thiollierei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Diaphus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:340Public Records:21
Specimens with Sequences:277Public Species:7
Specimens with Barcodes:275Public BINs:9
Species:38         
Species With Barcodes:34         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diaphus

Headlight fish (D. effulgens)

Diaphus is a genus of lanternfishes.

Species

There are currently 78 recognized species in this genus: [2]

References

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. http://strata.ummp.lsa.umich.edu/jack/showgenera.php?taxon=611&rank=class. Retrieved 2007-12-25.
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Diaphus in FishBase. April 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!