Overview

Distribution

Range Description

This large day gecko is naturally restricted to Madagascar, where it has been confirmed from the northeast and from the Sambirano region of the island's northwest (Raxworthy et al. 2007; Rocha et al. 2009, 2010), as well as from the island of Nosy Be. The lizard may be more widespread in northern Madagascar, and further research is needed to establish its occurrence within this range and the exact limits of its distribution. A population has been introduced to Mauritius, where it is widespread (N. Cole pers. comm. July 2011), and it has also become established on Runion (N. Cole pers. comm. July 2011). This species occurs from sea level, and has been recorded as high as 900 m asl. in Montagne d'Ambre. In its native range the species has an estimated extent of occurrence, based on the extent of known sites, of 9,235 km. As several records at the margins of the known distribution areas are very recent (Labanowski and Lowin 2011, Durkin et al. 2011), the gecko may be more widespread between known sites than is presently recognized.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Madagascar. Introduced and established on several islands in the Florida Keys (Krysko et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Indian-Ocean North-America
Distribution: N Madagascar;
Type locality: Madagascar, 25 km south of Diego Suarez (Antsiranana).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Although this species occurs in both intact and degraded native forests it is also found in other habitats, including orchards, where there is a good range of perches and an ample food supply (D'Cruze et al. 2009). It is common on large trees and on the walls of buildings in towns and villages.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phelsuma grandis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CATCGGCACTTTGTACCTTCTATTCGGCATTTGAGCAGGGATAATTGGATCGGCCCTAAGTCTATTGATCCGTACCGAACTAGGTCAACCAGGCTCATTCATAGGAGATGACCATATCTACAATGTAGTAGTTACAGCACATGCCTTCGTAATAATTTTCTTTATGGTTATACCCATTATGATCGGGGGATTTGGCAACTGATTAGTTCCCCTAATAATTGGTGCACCCGATATAGCCTTCCCACGACTGAACAATATAAGTTTTTGACTTTTACCACCCTCACTTATATTGCTTTTAGCCTCTACAACTGTGGAATCTGGTGCTGGCACAGGCTGAACTGCTTATCCTCCCTTATCAGCCAACCTCGCACATGCTGGCGCATCTATAGATCTCGTCATTTTCTCACTACACCTCGCTGGTATTTCCTCTATTCTAGGCGCAATCAACTTTATTACCACATGCTTAAACATAAAACCACCAGTAATAACACAATATAACACACCCCTATTTGTCTGATCCGTACTAATCACTGCTGTTCTATTACTGCTATCTCTGCCCGTTTTAGCAGCTGCCATTACAATACTGCTAACTGATCGTAATTTCAACACAACATTCTTTGACCCTGCAGGAGGAGGTGACCCTGTACTGTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phelsuma grandis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Ratsoavina, F., Glaw, F. & Rakotondrazafy, N.A.

Reviewer/s
Cox, N.A. & Bowles, P.

Contributor/s
Cole, N.

Justification
Listed as Least Concern on the basis that, while it has a known extent of occurrence of 9,226 km, it may be more widespread in northern Madagascar than currently indicated, it is apparently common and tolerant of disturbance within its known range, it is known from at least two protected areas, and there are no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: TNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species where it occurs, but is apparently local. It was by far the most abundant lizard encountered during a 20 day survey of Montagne des Franais, constituting 91 of 172 lizard records, 78 of which were taken in orchards (D'Cruze and Kumar 2011). There is no information on population trends.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is highly tolerant of habitat modification. It may be subject to locally high levels of collection for the pet trade (D'Cruze et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in anthropogenic habitats as well as native forest, including protected forests in Montagne d'Ambre National Park and the new protected area at Montagne des Franais. The taxon was recently elevated to a full species and it is now important to update its distribution, biological and ecological information. Updates to the CITES database and national legislation are needed in light of the taxonomic changes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Phelsuma grandis

Phelsuma grandis Gray, 1870, is a diurnal arboreal species of day gecko (Phelsuma spp.). These geckos are part of the Phelsuma group, which consists of in excess of 70 species and subspecies. They are commonly referred to as the Madagascar giant day gecko, due to their large size. They are found in areas of tropical and subtropical forest in northern Madagascar. P. grandis feeds on various invertebrates, very small vertebrates, and nectars.

Description[edit]

P. madagascariensis grandis in captivity, Cincinnati Zoo

This lizard reaches a total length of 30 centimetres (12 in).[1] The body colour is bright green or, rarely, bluish green. A red stripe extends from the nostril to the eye. On the back there are typically red coloured dots or bars. These red markings are quite variable, and in some cases, completely absent, though the line extending from the nostril to the eye is always present. Some specimens may have small blue spots. Adult specimens may have large sacs on their necks. These are stored calcium sacks. Young individuals of the species often exhibit much more red than their parents, but as time passes, many of the markings fade, to leave those that will stay for the remainder of the gecko's life. The underside of these animals is a creamy white ranging to an eggy yellow. When stressed, the colouration darkens, rendering the whole animal a dark green, and the red markings on the face and back more orange in hue.

Distribution[edit]

This species is widely distributed in northern and northwest Madagascar. It can also be found on some of the off shore islets. There are a few recorded populations of this species also in Florida, and Hawaii, introduced by accident, which seem to like the hot, tropical climate in these locations.[2] It can also be found in Mauritius, mainly in Floreal and in the upper Plain Wilhems, but it is thought that it was introduced there too.

Habitat[edit]

Madagascar Giant Day Gecko

Phelsuma grandis is often found on different trees where it can be seen basking. They also inhabit human dwellings due to the number of appropriate basking spots, and the level of insect activity which these dwellings attract. The climate is rather dry, though heavy rainfalls are quite common. This means that there is a constant level of high humidity throughout the year. When in captivity Phelsuma grandis enjoy bamboo. Most live on the eastern coast of Madagascar.

Diet[edit]

These day geckos feed on various insects and other invertebrates, and occasionally have been recorded consuming small vertebrates. They also like to lick soft, sweet fruit, pollen and nectar. Geckos in the wild and in captivity have been observed consuming their own young.

Behaviour[edit]

Like most Phelsuma species, the males can be quite quarrelsome and territorial and will not accept other males in their neighborhood. They only allow females to enter their territory. In captivity, where the females cannot escape, the males can also sometimes seriously wound a female. In this case the male and female must be separated. Breeding behavior includes, the shaking of the tail or body, vocalizing, and if the female does not accept the male she may turn a darker green. The day geckos may move slowly, but when they are startled they can move very fast. They are known for being very good at escaping their enclosures. Giant day geckos have no eyelids. To keep their eyes clean, they often lick them.

Common Diseases and Disorders[edit]

Every once in a while giant day geckos will have a bad shed. The gecko has skin that does not come off the body. This is common and if the skin doesn’t come off after 24 hours an increase in humidity helps loosen up its old skin. Many day geckos have problems shedding the skin of their feet. This is of great importance to the day gecko considering they are arboreal. Another large problem with giant day geckos is metabolic bone disease. This happens when the gecko doesn’t get enough calcium. This can be prevented by making sure your giant day gecko gets plenty of calcium supplements and an appropriate level of ultra-violet light

Reproduction[edit]

The breeding season is between November and the first weeks of May. During this period, the females lay up to 6 pairs of eggs. At a temperature of 28 °C, the young will hatch after approximately 60–65 days. The juveniles measure 70 mm and reach sexual maturity after one year.

Nomenclature[edit]

The species Phelsuma grandis Gray 1870 was elevated from subspecies status (P. madagascariensis grandis) by Raxworthy et al. in 2007,[3] after environmental niche modeling revealed significant and reliable differences between it and other members of the P. madagascariensis-clade. This elevation has since received further molecular support.[4] P. grandis possesses also the junior synonyms Phelsuma madagascariensis venusta Mertens, 1964 and Phelsuma madagascariensis notissima Mertens, 1970 (fide Meier, 1982). The common name, appended to the current accepted name, has been given as Madagascar giant day gecko or variants such as Giant Day Gecko.[2]

Care and maintenance in captivity[edit]

P. madagascariensis grandis in captivity, Budapest Zoo

These animals should be housed in pairs or singles and need a large, well planted terrarium. When housed alone they should have at least a 10 gallon terrarium. When housed in pairs they should have at least a 29 gallon terrarium. These geckos need many limbs to crawl and bask on. They prefer horizontal and diagonal perches. An excess of vertical perches can result in a condition known among keepers as "tail-flop", wherein the tail hangs perpendicular to the body when the geckos are facing head-down. Giant day geckos need light with both UVA and UVB 5.0% which is necessary for them to metabolise calcium. The temperature should be between 25 and 28 °C, never falling below 17 °C, and never exceeding 36 °C. The humidity should be maintained between 65 and 75%. These geckos desiccate easily and quickly, so falling below this range can be dangerous. Keeping the geckos at humidity above this range can be done, but levels which are too high can introduce dangerous bacteria quickly. In captivity, these animals can be fed with crickets, wax moths, wax worms, pinky mice, fruit flies, mealworms and houseflies dusted with calcium supplement.

References[edit]

  1. ^ Glaw, F. and Vences, M. (2007).A Field Guide to the Amphibians and Reptiles of Madagascar. 3rd edition. ISBN 978-3-929449-03-7
  2. ^ a b "Giant Day Gecko". Geckoweb. Finding Species. Retrieved 2009-01-27. 
  3. ^ Raxworthy, C.J.; C.M. Ingram; N. Rabibisoa and R.G. Pearson (2007) Applications of Ecological Niche Modeling for Species Delimitation: A Review and Empirical Evaluation Using Day Geckos (Phelsuma) from Madagascar. Systematic Biology 56(6):907-923
  4. ^ Rocha, S.; H. Rösler; P.-S. Gehring; F. Glaw; D. Posada; D.J. Harris; M. Vences (2010) Phylogenetic systematics of day geckos, genus Phelsuma, based on molecular and morphological data (Squamata: Gekkonidae) Zootaxa 2429:1-28
  • Henkel, F.-W. and W. Schmidt (1995) Amphibien und Reptilien Madagaskars, der Maskarenen, Seychellen und Komoren. Ulmer Stuttgart. ISBN 3-8001-7323-9
  • McKeown, Sean (1993) The general care and maintenance of day geckos. Advanced Vivarium Systems, Lakeside CA.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!