You are viewing this Genus as classified by:

Ecology

Habitat

Depth range based on 3716 specimens in 85 taxa.
Water temperature and chemistry ranges based on 2314 samples.

Environmental ranges
  Depth range (m): 0 - 660
  Temperature range (°C): 13.979 - 29.336
  Nitrate (umol/L): 0.000 - 27.326
  Salinity (PPS): 30.220 - 38.808
  Oxygen (ml/l): 1.197 - 5.307
  Phosphate (umol/l): 0.036 - 2.029
  Silicate (umol/l): 0.380 - 27.099

Graphical representation

Depth range (m): 0 - 660

Temperature range (°C): 13.979 - 29.336

Nitrate (umol/L): 0.000 - 27.326

Salinity (PPS): 30.220 - 38.808

Oxygen (ml/l): 1.197 - 5.307

Phosphate (umol/l): 0.036 - 2.029

Silicate (umol/l): 0.380 - 27.099
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCCGAGCTGAGCCAACCTGGAGCTCTACTTGGCGATGATCAGATCTATAATGTAATTGTTACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTTGGAAACTGACTCGTCCCACTTATAATCGGTGCCCCAGATATAGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTTCCCCCGTCTTTCCTGCTCCTTCTAGCCTCTTCTGGGGTAGAAGCCGGCGCTGGTACTGGTTGAACAGTTTACCCGCCCCTAGCGGGCAATCTAGCCCACGCAGGTGCATCTGTAGACCTGACTATCTTCTCCCTTCATCTTGCAGGGATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCATCATTAACATGAAACCCCCAGCCATCTCTCAGTATCAAACACCTTTATTTGTGTGAGCCGTCCTAATTACAGCAGTGTTACTGCTCCTCTCCCTCCCTGTTCTTGCCGCCGGCATTACAATACTTCTAACGGATCGTAATCTCAACACCACTTTCTTTGACCCGGCTGGAGGGGGTGATCCCATCCTTTACCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,227Public Records:460
Specimens with Sequences:1,105Public Species:54
Specimens with Barcodes:988Public BINs:63
Species:82         
Species With Barcodes:80         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Epinephelus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Epinephelus

Epinephelus is a genus of groupers. They are large sea fish. Members of this genus may also be called a Mero.

Species

FishBase lists 99 species:

Epinephelus malabaricus (Malabar grouper)

References

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. Retrieved 2008-01-08. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!