Ecology
Habitat
Depth range based on 3716 specimens in 85 taxa.
Water temperature and chemistry ranges based on 2314 samples.
Environmental ranges
Depth range (m): 0 - 660
Temperature range (°C): 13.979 - 29.336
Nitrate (umol/L): 0.000 - 27.326
Salinity (PPS): 30.220 - 38.808
Oxygen (ml/l): 1.197 - 5.307
Phosphate (umol/l): 0.036 - 2.029
Silicate (umol/l): 0.380 - 27.099
Graphical representation
Depth range (m): 0 - 660
Temperature range (°C): 13.979 - 29.336
Nitrate (umol/L): 0.000 - 27.326
Salinity (PPS): 30.220 - 38.808
Oxygen (ml/l): 1.197 - 5.307
Phosphate (umol/l): 0.036 - 2.029
Silicate (umol/l): 0.380 - 27.099
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2314 samples.
Environmental ranges
Depth range (m): 0 - 660
Temperature range (°C): 13.979 - 29.336
Nitrate (umol/L): 0.000 - 27.326
Salinity (PPS): 30.220 - 38.808
Oxygen (ml/l): 1.197 - 5.307
Phosphate (umol/l): 0.036 - 2.029
Silicate (umol/l): 0.380 - 27.099
Graphical representation
Depth range (m): 0 - 660
Temperature range (°C): 13.979 - 29.336
Nitrate (umol/L): 0.000 - 27.326
Salinity (PPS): 30.220 - 38.808
Oxygen (ml/l): 1.197 - 5.307
Phosphate (umol/l): 0.036 - 2.029
Silicate (umol/l): 0.380 - 27.099
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Epinephelus sp.
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCCGAGCTGAGCCAACCTGGAGCTCTACTTGGCGATGATCAGATCTATAATGTAATTGTTACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTTGGAAACTGACTCGTCCCACTTATAATCGGTGCCCCAGATATAGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTTCCCCCGTCTTTCCTGCTCCTTCTAGCCTCTTCTGGGGTAGAAGCCGGCGCTGGTACTGGTTGAACAGTTTACCCGCCCCTAGCGGGCAATCTAGCCCACGCAGGTGCATCTGTAGACCTGACTATCTTCTCCCTTCATCTTGCAGGGATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCATCATTAACATGAAACCCCCAGCCATCTCTCAGTATCAAACACCTTTATTTGTGTGAGCCGTCCTAATTACAGCAGTGTTACTGCTCCTCTCCCTCCCTGTTCTTGCCGCCGGCATTACAATACTTCTAACGGATCGTAATCTCAACACCACTTTCTTTGACCCGGCTGGAGGGGGTGATCCCATCCTTTACCAACATCTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Epinephelus sp.
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 1,227 | Public Records: | 460 |
| Specimens with Sequences: | 1,105 | Public Species: | 54 |
| Specimens with Barcodes: | 988 | Public BINs: | 63 |
| Species: | 82 | ||
| Species With Barcodes: | 80 | ||
Trusted
Barcode data
Trusted
Locations of barcode samples
Trusted
Wikipedia
Epinephelus
Epinephelus is a genus of groupers. They are large sea fish. Members of this genus may also be called a Mero.
Species
FishBase lists 99 species:
- Areolate grouper, Epinephelus areolatus (Forsskål, 1775).
- Atlantic goliath grouper, Epinephelus itajara (Lichtenstein, 1822).
- Banded grouper, Epinephelus amblycephalus (Bleeker, 1857).
- Barred-chest grouper, Epinephelus faveatus (Valenciennes, 1828).
- Black-dotted grouper, Epinephelus stictus Randall & Allen, 1987.
- Blacksaddle grouper, Epinephelus howlandi (Günther, 1873).
- Blacktip grouper, Epinephelus fasciatus (Forsskål, 1775).
- Blue and yellow grouper, Epinephelus flavocaeruleus (Lacépède, 1802).
- Bridled grouper, Epinephelus heniochus Fowler, 1904.
- Brown-marbled grouper, Epinephelus fuscoguttatus (Forsskål, 1775).
- Brownspotted grouper, Epinephelus chlorostigma (Valenciennes, 1828).
- Camouflage grouper, Epinephelus polyphekadion (Bleeker, 1849).
- Catface grouper, Epinephelus andersoni Boulenger, 1903.
- Clipperton grouper, Epinephelus clippertonensis Allen & Robertson, 1999.
- Cloudy grouper, Epinephelus erythrurus (Valenciennes, 1828).
- Comet grouper, Epinephelus morrhua (Valenciennes, 1833).
- Convict grouper, Epinephelus septemfasciatus (Thunberg, 1793).
- Coral grouper, Epinephelus corallicola (Valenciennes, 1828).
- Darwin grouper, Epinephelus darwinensis Randall & Heemstra, 1991.
- Dogtooth grouper, Epinephelus caninus (Valenciennes, 1843).
- Dot-dash grouper, Epinephelus poecilonotus (Temminck & Schlegel, 1842).
- Dotted grouper, Epinephelus epistictus (Temminck & Schlegel, 1842).
- Dungat grouper, Epinephelus goreensis (Valenciennes, 1830).
- Dusky grouper, Epinephelus marginatus (Lowe, 1834).
- Duskytail grouper, Epinephelus bleekeri (Vaillant, 1878).
- Eightbar grouper, Epinephelus octofasciatus Griffin, 1926.
- Epaulet grouper, Epinephelus stoliczkae (Day, 1875).
- Foursaddle grouper, Epinephelus spilotoceps Schultz, 1953.
- Giant grouper, Epinephelus lanceolatus (Bloch, 1790).
- Goldblotch grouper, Epinephelus costae (Steindachner, 1878).
- Greasy grouper, Epinephelus tauvina (Forsskål, 1775).
- Haifa grouper, Epinephelus haifensis Ben-Tuvia, 1953.
- Halfmoon grouper, Epinephelus rivulatus (Valenciennes, 1830).
- Hawaiian grouper, Epinephelus quernus Seale, 1901.
- Highfin grouper, Epinephelus maculatus (Bloch, 1790).
- Honeycomb grouper, Epinephelus merra Bloch, 1793.
- Hong Kong grouper, Epinephelus akaara (Temminck & Schlegel, 1842).
- Longfin grouper, Epinephelus quoyanus (Valenciennes, 1830).
- Longspine grouper, Epinephelus longispinis (Kner, 1864).
- Longtooth grouper, Epinephelus bruneus Bloch, 1793.
Epinephelus malabaricus (Malabar grouper)
- Malabar grouper, Epinephelus malabaricus (Bloch & Schneider, 1801).
- Maori grouper, Epinephelus undulatostriatus (Peters, 1866).
- Marquesan grouper, Epinephelus irroratus (Forster, 1801).
- Misty grouper, Epinephelus mystacinus (Poey, 1852).
- Moustache grouper, Epinephelus chabaudi (Castelnau, 1861).
- Multispotted grouper, Epinephelus gabriellae Randall & Heemstra, 1991.
- Mystery grouper, Epinephelus lebretonianus (Hombron & Jacquinot, 1853).
- Nassau grouper, Epinephelus striatus (Bloch, 1792).
- Netfin grouper, Epinephelus miliaris (Valenciennes, 1830).
- Oblique-banded grouper, Epinephelus radiatus (Day, 1868).
- Olive grouper, Epinephelus cifuentesi Lavenberg & Grove, 1993.
- One-blotch grouper, Epinephelus melanostigma Schultz, 1953.
- Orange-spotted grouper, Epinephelus coioides (Hamilton, 1822).
- Pacific Goliath grouper, Epinephelus quinquefasciatus, (Lichtenstein, 1822).
- Palemargin grouper, Epinephelus bontoides (Bleeker, 1855).
- Plump grouper, Epinephelus trophis Randall & Allen, 1987.
- Potato grouper, Epinephelus tukula Morgans, 1959 Also known as Potato bass or cod.
- Puzzling grouper, Epinephelus perplexus Randall, Hoese & Last, 1991.
- Red grouper, Epinephelus morio (Valenciennes, 1828).
- Red hind, Epinephelus guttatus (Linnaeus, 1758).
- Red-tipped grouper, Epinephelus retouti Bleeker, 1868.
- Reticulate grouper, Epinephelus tuamotuensis Fourmanoir, 1971.
- Rock grouper, Epinephelus fasciatomaculosus (Peters, 1865).
- Rock hind, Epinephelus adscensionis (Osbeck, 1765).
- Rooster hind, Epinephelus acanthistius (Gilbert, 1892).
- Saddletail grouper, Epinephelus daemelii (Günther, 1876).
- Seamount grouper, Epinephelus suborbitalis Amaoka & Randall, 1990.
- Sevenbar grouper, Epinephelus ergastularius Whitley, 1930.
- Sixbar grouper, Epinephelus sexfasciatus (Valenciennes, 1828).
- Smallscaled grouper, Epinephelus polylepis Randall & Heemstra, 1991.
- Snowy grouper, Epinephelus niveatus (Valenciennes, 1828).
- Snubnose grouper, Epinephelus macrospilos (Bleeker, 1855).
- Somali grouper, Epinephelus indistinctus Randall & Heemstra, 1991.
- Speckled blue grouper, Epinephelus cyanopodus (Richardson, 1846).
- Speckled grouper, Epinephelus magniscuttis Postel, Fourmanoir & Guézé, 1963.
- Speckled hind, Epinephelus drummondhayi Goode & Bean, 1878.
- Spinycheek grouper, Epinephelus diacanthus (Valenciennes, 1828).
- Spotted grouper, Epinephelus analogus Gill, 1863.
- Starry grouper, Epinephelus labriformis (Jenyns, 1840).
- Starspotted grouper, Epinephelus hexagonatus (Forster, 1801).
- Star-studded grouper, Epinephelus niphobles Gilbert & Starks, 1897.
- Striped grouper, Epinephelus latifasciatus (Temminck & Schlegel, 1842).
- Striped-fin grouper, Epinephelus posteli Fourmanoir & Crosnier, 1964.
- Summan grouper, Epinephelus summana (Forsskål, 1775).
- Surge grouper, Epinephelus socialis (Günther, 1873).
- Tenspine grouper, Epinephelus exsul (Fowler, 1944).
- Threespot grouper, Epinephelus trimaculatus (Valenciennes, 1828).
- Tonga grouper, Epinephelus chlorocephalus (Valenciennes, 1830).
- Twinspot grouper, Epinephelus bilobatus Randall & Allen, 1987.
- Warsaw grouper, Epinephelus nigritus (Holbrook, 1855).
- Wavy-lined grouper, Epinephelus undulosus (Quoy & Gaimard, 1824).
- White grouper, Epinephelus aeneus (Geoffroy Saint-Hilaire, 1817).
- White-blotched grouper, Epinephelus multinotatus (Peters, 1876).
- White-dotted grouper, Epinephelus polystigma (Bleeker, 1853).
- White-edged grouper, Epinephelus albomarginatus Boulenger, 1903.
- Whitespotted grouper, Epinephelus coeruleopunctatus (Bloch, 1790).
- White-streaked grouper, Epinephelus ongus (Bloch, 1790).
- Yellow grouper, Epinephelus awoara (Temminck & Schlegel, 1842).
- Yellowedge grouper, Epinephelus flavolimbatus Poey, 1865.
- Yellowspotted grouper, Epinephelus timorensis Randall & Allen, 1987.
References
- ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. Retrieved 2008-01-08.
- "Epinephelus". Integrated Taxonomic Information System. Retrieved 6 June 2006.
- Froese, Rainer, and Daniel Pauly, eds. (2006). Species of Epinephelus in FishBase. January 2006 version.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

