Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella erlangeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACCAATCACAAGGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATACTAGGAACCGCTTTAAGCTTGCTAATCCGTGCCGAACTAGGTCAACCCGGAACTTTACTCGGAGATGACCAGATTTATAATGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGGTTTGGTAACTGACTAGTTCCTCTAATAATCGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTCCTATTACTTCTGGCATCCTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGTAACCTAGCTCACGCAGGTGCTTCAGTAGATTTAACCATTTTCTCCCTTCACCTAGCAGGTGTCTCTTCAATTTTAGGCGCTATCAACTTTATTACAACAATTATTAATATAAAACCTCCTGCAATATCGCAATACCAAACCCCCTTATTTGTATGATCTGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTCCCCGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGATCCAATCCTTTATCAACATCTATTCTGATTCTTCGGACATCCTGAAGTATATATTCTAATCCTACCCGGATTCGGGATAATTTCTCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATAGTATGAGCCATGATGTCTATTGGGTTCTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGAATGGACGTTGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCCATCCCAACTGGGGTAAAAGTCTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGATCACCTGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTCCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTTCACTATGTTCTATCAATAGGAGCTGTATTTGCTATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCTAAAATTCACTTCGCAATTATATTTGTAGGCGTAAACATAACTTTCTTCCCACAACATTTCTTAGGGCTATCCGGAATACCACGACGATACTCTGATTATCCCGATGCCTATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATATTAATAATTTTTATCATTTGAGAAGCATTTGCATCCAAACGAGAAGTTCTAACCGTAGACCTTACCACAACAAATTTAGAGTGACTAAATGGGTGTCCTCCCCCATACCACACATTTGAAGAGCCTACATACGTCAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazella erlangeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gazella erlangeri

Neumann’s gazelle or Erlanger’s gazelle (Gazella erlangeri) is a small dark gazelle with a stout body and short legs. It is described from Saudi Arabia and Yemen.[1]

It is considered a threatened species, although no recent information is available on wild populations. Some sources consider it a subspecies of the mountain gazelle (Gazella gazella).[2]

References

  1. ^ a b Grubb, P. (2005). "Gazella erlangeri". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200570.
  2. ^ a b IUCN SSC Antelope Specialist Group (2008). "Gazella gazella". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8970. Retrieved 22 August 2011.
  3. ^ Lydekker, R. (1914). Catalogue of the Ungulate Mammals in the British Museum (Natural History). Vol. III, Artiodactyla, families Bovidae, subfamilies Aepycerotinae tot Tragelaphinae (Pala, Saiga, Gazelles, Oryx Group, Bushbucks, Kudus, Elands, Etc., Antilocapridae (Prongbuck, and Giraffidae (Giraffes and Okapi). Wiliam Clowes and Sons Limited, London. Available online at: http://archive.org/details/catalogueofungul03brit.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!