Molecular Biology and Genetics

Molecular Biology

Barcode data: Polistes versicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATATGGTCAGGAATAATTGGAACATCTTTAAGATTAATCATTCGATTAGAGTTAGGAACTCCATTATCAATAATTAACAATGACCAAATTTATAATTCAATCATTACAGCCCATGCATTAATCATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGATTCGGAAATTGATTAATTCCCTTAATACTTGGAGCCCCTGATATAGCCTTCCCACGAATAAATAACATAAGATTCTGGTTACTACCCCCGTCCCTTCTCCTTCTATTAATTAGAAACATCAACGATATAGGGGTAGGAACAGGGTGAACTTTATACCCCCCATTATCATCAATCATAGGCCATAATTCATCCTCAGTAGATTTTGCCATTTTCTCACTTCATATCGCAGGTATTTCATCAATTATAGGCGCAATCAATTTTATTGTAACTATTATAAATATACATATTAAAACTCACTCATTAAATTTTTTACCTATATTTACATGATCAGTTTTAATTACAGCAATCTTATTGTTATTATCTTTACCTGTATTAGCAGGAGCCATCACTATATTATTAACCGATCGAAATTTAAATACATCATTTTTTGATCCTTTAGGGGGAGGTGACCCAATTTTATTCCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polistes versicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Polistes versicolor

Polistes versicolor is a subtropical social wasp within Polistes, the most common genus of the paper wasp.


Investigation of potential copyright issue

Do not restore or edit the blanked content on this page until the issue is resolved by an administrator, copyright clerk or OTRS agent.

If you have just labeled this page as a potential copyright issue, please follow the instructions for filing at the bottom of the box.

The previous content of this page or section has been identified as posing a potential copyright issue, as a copy or modification of the text from the source(s) below, and is now listed on Wikipedia:Copyright problems (listing):


 

Unless the copyright status of the text on this page is clarified, the problematic text or the entire page may be deleted one week after the time of its listing.
Temporarily, the original posting is still accessible for viewing in the page history.

Can you help resolve this issue?
About importing text to Wikipedia
For more details on this topic, see Wikipedia:Copying text from other sources.
  • Posting copyrighted material without the express permission of the copyright holder is unlawful and against Wikipedia policy.
  • If you have express permission, this must be verified either by explicit release at the source or by e-mail or letter to the Wikimedia Foundation. See Wikipedia:Declaration of consent for all enquiries.
  • Policy requires that we block those who repeatedly post copyrighted material without express permission.
Instructions for filing

If you have tagged the article for investigation, please complete the following steps:

  • Add the following to the bottom of Wikipedia:Copyright_problems/2014 December 21
    * {{subst:article-cv|:Polistes versicolor}} from . ~~~~
  • Place this notice on the talk page of the contributor of the copyrighted material:
    {{subst:Nothanks-web|pg=Polistes versicolor|url=}} ~~~~
  • To blank a section instead of an entire article, add the template to the beginning of the section and </div> at the end of the portion you intend to blank.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!