Ecology

Habitat

Depth range based on 12 specimens in 5 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 6 - 142
  Temperature range (°C): 14.861 - 24.821
  Nitrate (umol/L): 0.171 - 2.763
  Salinity (PPS): 35.018 - 36.070
  Oxygen (ml/l): 4.302 - 5.463
  Phosphate (umol/l): 0.152 - 0.269
  Silicate (umol/l): 1.304 - 4.953

Graphical representation

Depth range (m): 6 - 142

Temperature range (°C): 14.861 - 24.821

Nitrate (umol/L): 0.171 - 2.763

Salinity (PPS): 35.018 - 36.070

Oxygen (ml/l): 4.302 - 5.463

Phosphate (umol/l): 0.152 - 0.269

Silicate (umol/l): 1.304 - 4.953
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus cf. japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTTCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCTCACGCCGGATCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAATCCTTCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus cf. japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:128Public Records:30
Specimens with Sequences:93Public Species:8
Specimens with Barcodes:65Public BINs:4
Species:11         
Species With Barcodes:11         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Orectolobus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orectolobus

Orectolobus is a genus of carpet sharks in the family Orectolobidae. They are commonly known as wobbegongs, although this name also applies to the other members of the family.[1] They are found in shallow temperate and tropical waters of the western Pacific Ocean and eastern Indian Ocean, chiefly around Australia and Indonesia, although one species (the Japanese wobbegong, O. japonicus) occurs as far north as Japan.

They have a mottled or spotted cryptic pattern, and have elongated dermal lobes in the region near the mouth. Most have a maximum length of 1.25 m (4.1 ft) or less, but two species, O. halei and O. maculatus, reach about 3 m (9.8 ft) (earlier reports of similar-sized O. ornatus is due to confusion with O. halei). These sluggish ambush predators are typically seen resting on the seafloor, and at least some species are nocturnal. While usually harmless to humans, they have been known to bite, but generally only if stepped on, approached too closely, or provoked.

Species[edit]

The species-level taxonomy in this genus has changed significantly in recent years, with one species described in 2006, three species described in 2008, and one in 2010, while O. halei generally was considered a junior synonym of O. ornatus until 2006. The tasselled and cobbler wobbegongs have been included in this genus, but today they are placed in Eucrossorhinus and Sutorectus, respectively.

References[edit]

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2011). Species of Orectolobus in FishBase. February 2011 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!