Overview

Comprehensive Description

[[ Genus Orectolobus ]]

Discussion

The very poor description of O. halei (Whitley, 1940) ZBK makes it impossible to quantitatively compare diagnostic features between the neotype herein designated and the previous description. The neotype was therefore assigned from the differing characters in “the color pattern and the form of the tentacles” as highlighted by Whitley (1940).

The aim of this paper was to define and redescribe O. halei ZBK and O. ornatus to facilitate species identification. Unfortunately, juvenile O. halei ZBK (smaller than 1100 mm) were not collected despite intensive searching over two years. The ranges of sizes of O. ornatus and O. halei ZBK examined did not overlap and thus differences in morphometry should be interpreted with caution due to allometric factors. Juvenile O. halei ZBK (smaller than 900 mm) are needed to confirm morphometric differences identified in this study.

The two species can, however, be differentiated using counts of precaudal vertebrae (greater than 105 in O. halei ZBK and less than 105 in O. ornatus ) and/or spiral valves (greater than 26 in O. halei ZBK and less than 26 in O. ornatus ). However, these characters are impractical for application in the field. Therefore, simpler but equally robust methods are needed to differentiate species under field conditions.

Total length is the simplest field character for differentiating NSW species. Any wobbegong exceeding 110 cm is either O. halei ZBK or O. maculatus (but not O. ornatus ) and these two can be easily differentiated using color pattern and dermal lobes. Wobbegongs smaller than 110 cm are harder to identify. In the case of small males, if the claspers are calcified, the species is O. ornatus . For immature males or females, other traits have to be used. Color pattern may help identification with O. ornatus , which is freckled and green/ gray (browner in O. halei ZBK ), and lacks black edges along its saddle markings (otherwise present). However, coloration is highly variable in these species and O. ornatus specimens have been observed with an halei-like color pattern. Care must therefore be taken when using coloration alone to identify Orectolobus species.

Three further key features to differentiate between the two species are the number of dermal lobes at the posterior preorbital group, the position of the pelvic fins, and the supraorbital knobs. Orectolobus ornatus usually has only three lobes at the posterior preorbital group, consisting of two branched lobes at the extremities and a shorter unbranched lobe in the middle (more lobes are present in O. halei ZBK ). However, both O. ornatus and O. halei ZBK have been observed with four lobes. Pelvic fins are located further back on O. halei ZBK with the pelvic-fin insertion at the level of the first dorsal midpoint ( O. ornatus has the pelvic-fin insertion anterior to the first dorsal midpoint). Lastly, O. halei ZBK has two small knobs on the supraorbit (absent in O. ornatus ).

By preference, these features should always be used together to maximize correct identification of Orectolobus species in NSW. Commercial fishers using these features should be able to identify Orectolobus species and report them accordingly. In the past, all species have been combined together as ‘carpet shark’. Commencing in 2005, NSW DPI has required fishers to report O. maculatus separately. Using the characteristics described above, fishers should now be able to report catches of O. maculatus , O. ornatus and O. halei ZBK separately. Catch rate statistics could then be used to assess each species independently to investigate potential population decline.

Key to Orectolobus species in New South Wales

1. About 6 to 10 dermal lobes at the posterior preorbital group; white O-shaped spots and white blotches............................................................................. Orectolobus maculatus

- About 3 to 6 dermal lobes at the posterior preorbital group; back with dark color variegated with blotches and prominent saddle markings....................................................2

2. Spiral valve whorl count 20-23; precaudal vertebrae count 98-104; size-at-maturity about 800 mm; about 3 to 4 dermal lobes at the posterior preorbital group; no supraocular knobs; pelvic-fin insertion slightly anterior to the first dorsal midpoint ................ ........................................................................................................ Orectolobus ornatus

- Spiral valve whorl count 29-32; precaudal vertebrae count 106-112; size-at-maturity about 1750 mm; about 4 to 6 dermal lobes at the posterior preorbital group; two distinct supraocular knobs; pelvic-fin insertion at about the level of the first dorsal midpoint .................................................................................................... Orectolobus halei ZBK

  • Charlie Huveneers (2006): Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284, 29-51: 48-50, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:CCA40A52-BD36-420A-BE62-56E3873CE064
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ Genus Orectolobus ]]

Introduction

Wobbegong sharks (family Orectolobidae Gill 1896 ) are bottom-dwelling sharks found in warm temperate to tropical continental waters of the western Pacific (Compagno 2001). They can be distinguished from all other sharks (except angel sharks, family Squatinidae) by their flattened and variegated bodies, and from all other elasmobranchs by possessing dermal lobes along the sides of the head. Wobbegongs also have a short, nearly terminal mouth in front of the eyes, nasoral grooves, circumnarial grooves and flaps, symphysial grooves, large spiracles and dorsolateral eyes (Compagno 2001).

The family currently comprises seven valid species that are divided into three recognized genera: Eucrossorhinus ZBK consisting of E. dasypogon (Bleeker 1867) ; Orectolobus consisting of O. japonicus Regan 1906 ZBK , O. maculatus (Bonnaterre 1788) , O. ornatus (De Vis 1883) , O. wardi Whitley 1939 ZBK , and O. hutchinsi Last et al. 2006 ; and Sutorectus ZBK consisting of S. tentaculatus (Peters 1864) . The systematics of the family is not fully resolved and two new species of wobbegongs from Western Australia have recently been identified (P. Last and J. Chidlow personal communication). Furthermore, new material from Indonesia (W. White personal communication), Borneo (Manjaji 2002) and the Philippines (Compagno et al. 2005) suggests that additional species exist in the IndoWest Pacific.

Two species, O. ornatus and O. maculatus , are thought to occur off temperate eastern Australia, but it has been suggested that other closely related species-level taxa may also be present. Whitley (1940) described the subspecies O. ornatus halei ZBK , from southern Australia and distinguished it from O. ornatus ornatus from northeastern waters by “differences in its color pattern and in the form of the tentacles around the head”. No further description was given by Whitley apart for the size of the holotype of 288.3 cm. Furthermore, some specimens of O. ornatus are mature at 70-80 cm total length (TL) which is considerably smaller than the normal size of maturity at about 175 cm TL (Last and Stevens, 1994; Chidlow, 2001). This discrepancy between ‘small’ and ‘large’ morphs of O. ornatus was observed by Last and Stevens (1994) but they could not resolve the alpha taxonomy because of the paucity of research material. The small morph has since been observed mating (S. Hartley 2004 personal communication), and small pregnant females are regularly caught in the targeted wobbegong commercial fishery (Huveneers unpublished data). Apart from these reports, there has been no positive evidence to support the existence of a third species off eastern and southern Australia. The original description of O. ornatus halei ZBK was inadequate and it has subsequently been considered as a synonym of O. ornatus (Compagno 2001).

Wobbegongs have been targeted off the eastern Australian state of New South Wales (NSW) by commercial fishers for at least 15 years. However, catches have declined over the past decade leading to public concern about the potential impact of the fishery on wobbegong populations (NSW Department of Primary Industries 2001). There are minimal management strategies specifically regulating wobbegong fisheries in NSW. Those currently in place directly applying to wobbegongs are a recreational bag limit of two wobbegongs per day, gear limit of no more than ten lines each with a maximum of six hooks when setlining within three nautical miles of the coast, and the defacto protection given to shared critical habitats with grey nurse shark ( Carcharias taurus ZBK ). The lack of specific strategies directed at wobbegong commercial fishing and the decline in catches, has resulted in O. ornatus and O. maculatus being listed as ‘Vulnerable’ in the IUCN Red List in NSW and as ‘Near Threatened’ globally (Cavanagh et al. 2003). NSW Department of Primary Industries (NSW DPI) has expressed the need for appropriate management to ensure the viability of wobbegong populations in NSW (NSW DPI 2001). Suitable regulations require knowledge of all wobbegongs species marketed in NSW, especially if the sizes at maturity and reproductive biology differ between those species. Consequently, the subspecies needed to be investigated to help distinguish them and assess their conspecificity. These taxa are shown to be non-conspecific and both taxa are fully described below. A taxonomic key to Orectolobus species in NSW is also provided.

  • Charlie Huveneers (2006): Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284, 29-51: 29-30, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:CCA40A52-BD36-420A-BE62-56E3873CE064
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 12 specimens in 5 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 6 - 142
  Temperature range (°C): 14.861 - 24.821
  Nitrate (umol/L): 0.171 - 2.763
  Salinity (PPS): 35.018 - 36.070
  Oxygen (ml/l): 4.302 - 5.463
  Phosphate (umol/l): 0.152 - 0.269
  Silicate (umol/l): 1.304 - 4.953

Graphical representation

Depth range (m): 6 - 142

Temperature range (°C): 14.861 - 24.821

Nitrate (umol/L): 0.171 - 2.763

Salinity (PPS): 35.018 - 36.070

Oxygen (ml/l): 4.302 - 5.463

Phosphate (umol/l): 0.152 - 0.269

Silicate (umol/l): 1.304 - 4.953
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus cf. japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTTCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCTCACGCCGGATCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAATCCTTCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus cf. japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 128
Specimens with Sequences: 93
Specimens with Barcodes: 65
Species: 11
Species With Barcodes: 11
Public Records: 30
Public Species: 8
Public BINs: 4
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orectolobus

Orectolobus is a genus of carpet sharks in the family Orectolobidae. They are commonly known as wobbegongs, although this name also applies to the other members of the family.[1] They are found in shallow temperate and tropical waters of the western Pacific Ocean and eastern Indian Ocean, chiefly around Australia and Indonesia, although one species (the Japanese wobbegong, O. japonicus) occurs as far north as Japan.

They have a mottled or spotted cryptic pattern, and have elongated dermal lobes in the region near the mouth. Most have a maximum length of 1.25 m (4.1 ft) or less, but two species, O. halei and O. maculatus, reach about 3 m (9.8 ft) (earlier reports of similar-sized O. ornatus is due to confusion with O. halei). These sluggish ambush predators are typically seen resting on the seafloor, and at least some species are nocturnal. While usually harmless to humans, they have been known to bite, but generally only if stepped on, approached too closely, or provoked.

Species[edit]

The species-level taxonomy in this genus has changed significantly in recent years, with one species described in 2006, three species described in 2008, and one in 2010, while O. halei generally was considered a junior synonym of O. ornatus until 2006. The tasselled and cobbler wobbegongs have been included in this genus, but today they are placed in Eucrossorhinus and Sutorectus, respectively.

References[edit]

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2011). Species of Orectolobus in FishBase. February 2011 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!