Physical Description

Diagnostic Description

Based on the new information added here, a total of eight Lutjanus species are now recorded from the southwestern Atlantic (Brazilian common names are in parentheses): L. alexandrei , the Brazilian snapper (“ baúna ”, “caranha”, “caranho”); L. analis (Cuvier) , the mutton snapper (“caranho-vermelho”, “cioba”, “saioba”); L. bucanella (Cuvier) , the blackfin snapper (“pargo-boca-preta”); L. cyanopterus (Cuvier) , the cubera snapper (“caranha”, “caranho”); L. jocu (Bloch & Schneider) , the dog snapper (“ dentão ”, “vermelho”); L. purpureus (Poey) , the southern red snapper (“pargo”, “vermelho”, “cachucho”); L. synagris (Linnaeus) , the lane snapper (“ greacó ”, “ ariocó ”, “vermelho-henrique”, “ baúna ”); and L. vivanus (Cuvier) , the silk snapper (“pargo”, “vermelho”). Brazilian records of L. mahogany (Cuvier) , the mahogany snapper are probably based on misidentifications (Carvalho-Filho 1994). As noted for the western North Atlantic (e.g. Camber 1955, Carpenter1965), common names used for snappers has been very inconsistent in the southwestern Atlantic.

 

Key to the Western Atlantic species of Lutjanus (modified from Allen 1985 and Anderson 2003)

 

1a. Dorsal fin with 10 spines and usually 12 soft rays (rarely 11 or 13)............................................................2

 

1b. Dorsal fin usually with 10 spines (rarely 9 or 11) and 14 soft rays (rarely 13 or 15)................................. 3

 

2a. Gill rakers 7-8 + 15-17 (including rudiments); 1/4 to 1/2 of black lateral spot extending below lateral line; no evident paler (yellow in life) stripes on body and head; angle of preopercle greatly projecting and strongly serrated........................................................................................................... L. mahogoni (Cuvier) [southeastern coast of Florida and eastern coast of Yucatan peninsula to Venezuela]

 

2b. Gill rakers 6-7 + 13-14 (including rudiments); less than 1/4 of black lateral spot extending below lateral line; 8-10 prominent paler (golden-yellow in life) stripes on body, often also 3-4 irregular paler (goldenyellow in life) stripes on head; angle of preopercle scarcely projecting and finely serrated......................... ................................................................................................................................... L. synagris (Linnaeus) [Bermuda and North Carolina to Santa Catarina, southern Brazil, including the West Indies, Gulf of Mexico, and Caribbean Sea]

 

3a. Large, pronounced black spot at base and in axil of pectoral fin in specimens larger than 5 cm SL; dark area at base of soft portion of dorsal fin (not always visible on preserved specimens); no black spot on flanks; anal fin rounded ............................................................................................ L. buccanella (Cuvier) [Bermuda and North Carolina to northeastern Brazil (at least to Bahia), including West Indies, Gulf of Mexico, and Caribbean Sea]

 

3b. No black spot at base or axil of pectoral fin no dark area at base of soft portion of dorsal fin; black spot on flanks may be present or absent; anal fin rounded or angulate .................................................................... 4

 

4a. Anal fin angulated, at least in specimens larger than 10 cm SL; middle anal-fin rays produced, the longest at least half length of head (rounded in L. analis , L. campechanus , L. purpureus and L. vivanus less than 4 to 6 cm SL); a black spot on flank (disappears in L. campechanus , L. purpureus and L. vivanus at about 20 cm SL) ......................................................................................................................................................... 5

 

4b. Anal fin rounded at all sizes, middle rays less than half the length of head; no dark spot on flank ............ 8

 

5a. Vomerine tooth path without a distinct medial posterior extension; anal soft rays usually 8 (rarely 7); iris red in life; spot on flanks below anterior part of soft dorsal fin distinct at all sizes, being relatively larger in smaller specimens .......................................................................................................... L. analis (Cuvier) [New England to São Paulo, southeastern Brazil, including West Indies, Gulf of Mexico, and Caribbean Sea]

 

5b. Vomerine tooth path triangular or anchor-shaped, with a medial posterior extension; anal soft rays 7 to 9; spot on flank below anterior part of soft dorsal fin distinct in smaller specimens but may be absent in specimens larger than 20 cm SL ( L. campechanus , L. purpureus and L. vivanus ) ............................................. 6

 

6a. Scales on sides of anterior part of body, below lateral line, conspicuously larger than those on posterior part of body; anal soft rays 9 (rarely 8); lateral line scales usually 47 or 49 (rarely 46 or 50); scales above lateral line 7 to 10, most frequently 8 or 9 ............................................................... L. campechanus (Poey) [North American coast from Massachussetts to the Florida Keys and in the Gulf of Mexico; rare north of the Carolinas]

 

6b. Scales on anterior part of body, below lateral line, not conspicuously larger than those on posterior part of body; anal soft rays 8 (rarely 7 or 9); lateral line scales usually 50 or 51 (rarely 49, 52 or 53); scales above lateral line 9 to 12, most frequently 10 or 11 ............................................................................................... 7

 

7a. Cheek scale rows 6 (rarely 5 or 7); scales above lateral line, on anterior part of body, smaller than those below; scales below lateral line 16 to 19; lateral spot on flank present on juveniles equal to, or larger than eye; iris red in live and freshly preserved specimens; sum of lateral scales and scales above and below lateral line usually 77 to 81 (rarely 76 or 82) .................................................................... L. purpureus (Poey) [Yucatan Peninsula and the southern coast of Cuba southeastward throughout the Caribbean and most of the Antilles to São Paulo, southeastern Brazil; also collected at localities off the Carolinas, Georgia, and Northeast Florida].

 

7b. Cheek scale rows 7 (rarely 8); scales on anterior part of body above lateral line, on anterior part of body, about equal in size to those below; scales below lateral line 20 to 24; lateral spot on flank, when present, smaller than eye; iris yellow in live and freshly preserved specimens; sum of lateral scales and scales above and below lateral line usually 82 to 87 (rarely 81 or 88) ..................................... L. vivanus (Cuvier) [Bermuda and North Carolina south to São Paulo, southeastern Brazil, including West Indies, Gulf of Mexico, and Caribbean Sea]

 

8a. Vomerine tooth patch without a distinct medial posterior extension; upper and lower canines very strong and about equally developed; cheek scales usually in 9 rows (rarely 8 or 10) ........ L. cyanopterus (Cuvier) [Nova Scotia and Bermuda south to São Paulo, southeastern Brazil, including West Indies, Gulf of Mexico, and Caribbean Sea]

 

8b. Vomerine tooth patch triangular or anchor-shaped, with a distinct medial posterior extension; upper canines larger than lower; cheek scales usually in 7 or 8 rows (rarely 5, 6 or 9) ........................................ 9

 

9a. Usually 9 to 10 scales between dorsal-fin origin and lateral line (rarely 8 or 11); 45-49 transverse scale rows on body; a triangle-shaped whitish bar between the ventral margin of the orbit and the area immediately posterior to the maxilla in specimens larger than 15 cm SL.................... L. jocu (Bloch & Schneider) [From Massachussets south to São Paulo, southeastern Brazil, including West Indies, Gulf of Mexico, and Caribbean Sea; rare north of Florida]

 

9b. Five to 7 scales between dorsal-fin origin and lateral line; usually 40 to 43 (rarely 39 or 44) transverse scale rows on body; no triangular whitish bar between the ventral margin of the orbit and the area immediately posterior to the maxillary...............................................................................................................10

 

10a. Scale rows below soft portion of dorsal fin oblique to the longitudinal body axis; no evident banding pattern on body..................................................................................................................... L. griseus (Cuvier) [Massachussets and Bermuda to French Guiana, including West Indies, Gulf of Mexico, and Caribbean Sea]

 

10b. Scale rows parallel to the longitudinal body axis, not becoming oblique below the posterior portion of soft dorsal fin; evident banding pattern on body (may disappear in preserved specimens)......................11

 

11a. Yellowish to gray fins and body; eight pale vertical lines usually present separating darker bands on dorsal surface of flank; sixth pale vertical line under the junction of spiny and soft portions of dorsal fin; no conspicuous dark spots on cheek and preopercle ...................................................... L. apodus (Walbaum) [Massachusetts and Bermuda south to Tobago, including West Indies, Gulf of Mexico, and Caribbean Sea]

 

11b. Reddish fins and body; six white vertical lines separating darker bands on dorsal surface of flanks; fifth paler vertical bar under junction of spiny and soft portions of dorsal fin; conspicuous dark spots (bright blue in life) on cheek and preopercle, 7-10 of these typically present with varying placement on snout and ventral portion of head ................................................................................................... L. alexandrein. sp. [Tropical southwestern Atlantic, from Maranhão to Bahia, Brazil]

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8085 specimens in 67 taxa.
Water temperature and chemistry ranges based on 4961 samples.

Environmental ranges
  Depth range (m): 0 - 503
  Temperature range (°C): 6.140 - 29.336
  Nitrate (umol/L): 0.000 - 39.811
  Salinity (PPS): 30.220 - 40.307
  Oxygen (ml/l): 0.321 - 5.074
  Phosphate (umol/l): 0.025 - 3.216
  Silicate (umol/l): 0.380 - 81.249

Graphical representation

Depth range (m): 0 - 503

Temperature range (°C): 6.140 - 29.336

Nitrate (umol/L): 0.000 - 39.811

Salinity (PPS): 30.220 - 40.307

Oxygen (ml/l): 0.321 - 5.074

Phosphate (umol/l): 0.025 - 3.216

Silicate (umol/l): 0.380 - 81.249
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus cf. bengalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTAAGCCTGCTCATCCGAGCAGAACTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGATTTGGAAACTGACTAATTCCCCTAATGATCGGAGCCCCTGACATGGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCCCCATCATTTCTTCTACTCCTAGCCTCCTCAGGAGTAGAGGCAGGTGCTGGGACTGGATGAACAGTCTACCCTCCCCTGGCAGGAAACCTCGCGCACGCAGGGGCATCAGTCGACCTAACTATTTTCTCCCTTCACTTAGCGGGTGTCTCTTCAATTCTAGGGGCCATTAACTTCATTACCACAATTGTTAACATGAAACCCCCAGCCATTTCCCAGTATCAAACACCACTATTCGTTTGAGCCGTTCTAATTACCGCTGTACTACTCCTTCTATCCCTTCCAGTTCTAGCTGCCGGAATTACAATACTTCTTACAGATCGAAATCTAAACACCACCTTCTTTGACCCTGCAGGAGGGGGAGACCCCATCCTCTACCAGCATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus cf. bengalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus cf. russellii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,450Public Records:562
Specimens with Sequences:1,245Public Species:45
Specimens with Barcodes:1,223Public BINs:46
Species:64         
Species With Barcodes:61         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Lutjanus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!