Physical Description

Diagnostic Description

Four species of Labeo have been reported so far from the Nile basin, excluding Lake Victoria, i.e. Labeo niloticus ( Forskål , 1775) , L. horie Heckel, 1847 , L. coubie Rüppel , 1832 and L. forskalii Rüppel , 1835 (Heckel, 1847; Sandon, 1950; Abu-Gideiri, 1984; Bailey, 1994). In January 2006 during an ichthyological investigation on the River Nile in the Republic of Sudan a small Labeo species was found, similar in general appearance to L. ogunensis Boulenger, 1910 from West Africa. Morphometrics and meristics, however, soon revealed differences from every Labeo species described until know. Herein the new species L. meroensis is described using meristics, morphometrics and live coloration.

License not applicable

Timo Moritz

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:787Public Records:367
Specimens with Sequences:702Public Species:42
Specimens with Barcodes:702Public BINs:46
Species:59         
Species With Barcodes:56         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Labeo cf. cyclorhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCCTAAGCCTCCTCATTCGAGCTGAATTAAGCCAACCCGGATCGCTTCTCGGTGACGACCAAATTTATAATGTTATCGTAACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTGTCCTTATTGGGGGATTTGGAAACTGACTTGTACCACTAATGATCGGAGCCCCGGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTACCCCCATCATTCCTACTATTACTAGCTTCTTCTGGTGTTGAGGCTGGAGCTGGGACAGGATGAACGGTATACCCACCTCTTGCAGGCAACTTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTCCACTTAGCAGGGGTCTCATCAATTTTAGGGGCCATTAATTTTATTACTACAACCATTAACATGAAGCCTCCAGCTATTTCACAATATCAAACACCCCTATTCGTTTGATCCGTACTTGTTACTGCCGTGCTGCTTCTCTTATCGCTGCCAGTACTGGCAGCGGGCATCACAATGCTTTTAACAGATCGAAATCTTAATACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. cyclorhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Labeo cf. boga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. boga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Labeo cf. coubie

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTCATTCGAGCTGAGTTAAGCCAGCCCGGATCGCTTCTCGGCGATGACCAAATTTATAATGTTATCGTAACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCTGTCCTTATCGGAGGGTTTGGAAACTGACTCGTACCATTAATAATTGGAGCCCCAGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTCCTACCTCCATCATTCCTATTACTGCTAGCCTCTTCTGGTGTCGAAGCCGGGGCCGGAACAGGATGAACAGTATACCCACCTCTCGCAGGCAACTTAGCCCACGCAGGAGCATCAGTAGACCTGACAATTTTCTCGCTTCACTTAGCGGGGGTCTCATCAATTTTAGGGGCTATTAATTTTATTACTACAACCATTAATATAAAACCCCCAGCCATTTCACAATACCAAACACCCCTATTCGTCTGATCCGTGCTTGTAACCGCTGTACTACTTCTCCTATCGCTACCAGTACTGGCAGCGGGCATTACAATGCTTTTAACAGATCGAAATCTTAATACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. coubie

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Labeo cf. maleboensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. maleboensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Labeo cf. parvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. parvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Labeo

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Labeo

Labeo is a genus of carps in the family Cyprinidae. They are found mainly in the Old World tropics.

It contains the typical labeos in the subfamily Labeoninae, which may not be a valid group, however, and is often included in the Cyprininae as tribe Labeonini. If the Labeoninae are accepted as distinct, Labeonini is the name of the tribe in this subfamily to which the labeos belong. If the Labeonini are considered a tribe of the Cyprininae, the labeos are placed in subtribe Labeoina.

The labeos appear fairly similar to the "freshwater sharks" of the genus Epalzeorhynchos, which is also part of the Labeoninae (or Labeonini), but is not very closely related. Labeos are larger, and have a more spindle-shaped body, as they are mostly free-swimming rather than benthic like Epalzeorhynchos. Their mouths look very different, too; they have a pronounced rostral cap, which covers the upper lip except when feeding. The lips are expanded into thick, sausage-shaped pads which have keratinized edges. Thus, their mouth parts are moderately apomorphic; not as little-developed as in barbs or in Epalzeorhynchos, but neither as extensive as in, for example, Garra or Ptychidio.[1] The genus name Labeo is Latin for "one who has large lips".[2]

Labeos have the two barbels on the rostrum which are common among the Cyprinidae, and also another pair of barbels at the rear edges of the lower maxilla, which has been lost in some of their relatives. They have a well-developed vomeropalatine organ. In the Weberian apparatus, the posterior supraneural bone is elongated and contacts the skull at the forward end.[1]

Species[edit]

There are currently 103 recognized species in this genus:[3]

References[edit]

  1. ^ a b Stiassny, M. L. and A. Getahun. (2007). An overview of labeonin relationships and the phylogenetic placement of the Afro-Asian genus Garra Hamilton, 1922 (Teleostei: Cyprinidae), with the description of five new species of Garra from Ethiopia, and a key to all African species. Zoological Journal of the Linnean Society 150(1), 41-83.
  2. ^ Froese, R. and D. Pauly. (Eds.) Labeo alluaudi. FishBase. 2011.
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Labeo in FishBase. December 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!