Overview

Comprehensive Description

[[ Labeo ]]

Four species of Labeo have been reported so far from the Nile basin, excluding Lake Victoria, i.e. Labeo niloticus ( Forskal , 1775) , L. horie Heckel, 1847 , L. coubie Rueppel , 1832 and L. forskalii Rueppel , 1835 (Heckel, 1847; Sandon, 1950; Abu-Gideiri, 1984; Bailey, 1994). In January 2006 during an ichthyological investigation on the River Nile in the Republic of Sudan a small Labeo species was found, similar in general appearance to L. ogunensis Boulenger, 1910 from West Africa. Morphometrics and meristics, however, soon revealed differences from every Labeo species described until know. Herein the new species L. meroensis is described using meristics, morphometrics and live coloration.

  • Timo Moritz (2007): Description of a new cyprinid species, Labeo meroensis n. sp. (Teleostei: Cyprinidae), from the River Nile. Zootaxa 1612, 55-62: 55-55, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:D6B4BF95-912E-47AD-9307-25A41BAD8D36
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ Genus Labeo Rueppell ]]

Practical key to Labeo species from the lower Congo River

(Note: numbers in parenthesis indicate value most commonly observed)

1 Papillate lips .................................................................................................................. 2

- Plicate lips ..................................................................................................................... 4

2 Upper edge of the dorsal fin straight or convex ............................................................ 3

- Upper edge of the dorsal fin falciform (or deeply concave); 11-12 dorsal branched rays, body striped; no dark spot on caudal peduncle and scaly caudal fin; scale formula: 35-38 (37); 41/2-61/2 (51/2); 3-5 (4); 15-18 (16) ..................................... L. weeksii ZBK

3 37 scales in lateral line; 16 scales around the caudal peduncle; upper edge of the dorsal fin straight or convex, with 9-10 branched rays; body striped; a dark spot on caudal peduncle and scaly caudal fin; barbels small and hidden; scale formula: 35-38 (37); 51/ 2;3-4 (4); 15-17(16) ....................................................................................... L. lineatus ZBK

- Less than 36 scales in lateral line; less than 16 scales around the caudal peduncle; upper edge of the dorsal fin always straight; body striped, a small spot at caudal peduncle; maxillary barbels large and visible; scale formula: 30-35 (34); 51/2;4;12-15 (13) ...................................................................................... L. maleboensis ZBK

4 Upper edge of the dorsal fin convex or straight ............................................................ 5

- Upper edge of the dorsal fin concave or falciform ........................................................ 7

5 Upper edge of the dorsal fin convex ............................................................................. 6

- Upper edge of the dorsal fin straight; 10-11 branched rays; flanks striped, scale formula: 37-39 (38); 61/2-71/2 (71/2); 4-5 (5); 16-19 (16) ................................. L. rectipinnis ZBK

6 Ten branched rays at the dorsal fin; flanks striped; scale formula: 35-37 (37); 51/2-61/2 (51/2); 3-4 (4); 16-17 (16) ................................................................................. L. degeni ZBK

- 11-14 branched rays at the dorsal fin; flanks not striped; scale formula: 35-38 (37); 51/2-61/2 (51/2); 4-5 (5); 15-17 (16) ............................................................. L. longipinnis ZBK

7 Upper edge of the dorsal fin concave; flanks striped or not, dark lateral band present or absent ............................................................................................................................. 8

- Upper edge of the dorsal fin falciform (sometimes deeply concave); eyes always in supero-lateral position ................................................................................................. 15

8 Flanks striped; interorbital profile flat; snout not prominent, without a transverse furrow and a fleshy upwardly directed appendage; pectoral fins distant from the origin of the pelvic fins; anal fin not reaching the scaly caudal fin; genital opening near the origin of the anal fin; maxillary barbels well developed; scale formula: 38-39; 61/2; 4-5; 16 ............................................................................................................ L. fulakariensis

- Flanks not striped, dark lateral band present or absent ................................................. 9

9 Dark lateral band present on the flanks ....................................................................... 10

- No dark lateral band on the flanks .............................................................................. 11

10 Snout with a small transverse furrow, no fleshy appendage at its end; usually small sized; scale formula: 33-36 (35); 31/2-51/2 (41/2); 3-4 (3); 12-16 (13) .............. L. parvus ZBK

- Snout with a deep transverse furrow and a fleshy appendage at its end; usually large sized; scale formula: 37-39 (38); 41/2-61/2 (51/2); 3-4 (4); 13-16 (14) ......... L. annectens ZBK

11 Usually 10 branched dorsal fin rays, maxillary barbels small and hidden .................. 12

- Usually 12 branched dorsal fin rays, dorsal fin deeply concave; maxillary barbels large, visible at the corners of the mouth; body variegated or uniformly dark brown (sometimes vague stripes present on the flanks); snout large and rounded; scale formula: 36-38 (37); 51/2-71/2(61/2); 4-5 (5); 16-21 (16) ........................... L. cyclorhynchus ZBK

12 Eyes large, in supero-lateral position; no transverse furrow or upwardly directed fleshy appendage at the end of the snout ............................................................................... 13

- Eyes small or exceedingly small, in supero or dorso-lateral position; transverse furrow and fleshy appendage present at the end of the snout ................................................. 14

13 Maxillary and rostral barbels very large; 19-26 scales around the caudal peduncle; snout prominent; scale formula: 38-41 (40); 61/2-91/2 (81/2); 5-7 (6); 19-26 (24) ........... ....................................................................................................................... L. barbatus ZBK

- Maxillary barbels small, hidden at the corner of the mouth; rostral barbels minuscule, hidden in the rostral furrow; snout very prominent without transverse furrow or a fleshy appendage, overhanging a very large mouth; scale formula: 37-39 (38); 51/2-71/2 (61/2); 4-5 (5); 16-20 (18) ....................................................................... L. macrostomus

14 61/2 to 71/2 scale rows between the lateral line and the origin of the dorsal fin; eyes small, in dorso-lateral position; snout with a transverse furrow and a small fleshy appendage at its end; scale formula: 36-40 (38); 51/2-71/2 (61/2); 3-5 (4); 17-21 (19) ..... ............................................................................................................................ L. nasus ZBK

- More than 71/2 scale rows between the lateral line and the origin of the dorsal fin; eyes exceedingly small, in dorso-lateral position; snout with a very well developed transverse furrow and a very well developed and upward fleshy appendage at its end; scale formula: 40-43 (42); 71/2-91/2 (81/2); 5-6 (6); 20-27 (24) .................................... L. sorex ZBK

15 Less than 37 scales in lateral line; usually less than 16 scale rows around the caudal peduncle; scale formula: 33-36 (36); 31/2-51/2 (41/2); 21/2-4 (3); 12-16 (13) .................. .................................................................................................................... L. chariensis ZBK

- More than 37 scales in lateral line; 16 or more scale rows around the caudal peduncle ..................................................................................................................................... 16

16 Large and oval dark spot on the caudal peduncle and on the scaly caudal fin; scale formula: 35-39 (38); 41/2-61/2 (51/2); 3-4 (4); 15-19 (16) ...................................... L. greenii ZBK

- No spot on the caudal peduncle; maxillary barbels developed, rostral barbels minuscule, but both hidden; scale formula: 37-39 (38); 61/2-81/2 (71/2); 4-6 (5); 18-21 (19).... .................................................................................................................... L. falcipinnis ZBK

  • Sinaseli M. Tshibwabwa, Melanie L. J. Stiassny, Robert C. Schelly (2006): Description of a new species of Labeo (Teleostei: Cyprinidae) from the lower Congo River. Zootaxa 1224, 33-44: 41-43, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:432790D3-8DEE-4499-816C-9C1963BAE14E
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ Genus Labeo Rueppell ]]

Cyprinid fishes of the genus Labeo have been divided into two groups on the basis of the anatomy of the inner surface of their lips which are either papillate or plicate (Tshibwabwa & Teugels, 1995). In the lower Congo region (from Pool Malebo to the Atlantic Ocean, see Thieme et al., 2005), the first group is represented by 3 species: Labeo lineatus Boulenger, 1898 ZBK , L. weeksii Boulenger, 1909 ZBK , and L. maleboensis Tshibwabwa, 1997 ZBK , and the second group is represented by 13 species: L. annectens Boulenger, 1903 ZBK , L. barbatus Boulenger, 1898 ZBK , L. chariensis Pellegrin, 1904 ZBK , L. cyclorhynchus Boulenger, 1899 ZBK , L. degeni Boulenger, 1920 ZBK , L. falcipinnis Boulenger, 1903 ZBK , L. greenii Boulenger, 1902 ZBK , L. longipinnis Boulenger, 1898 ZBK , L. macrostomus Boulenger, 1898 , L. nasus Boulenger, 1899 ZBK , L. parvus Boulenger, 1902 ZBK , L. rectipinnis Tshibwabwa, 1997 ZBK , and L. sorex Nichols and Griscom, 1917 ZBK (Tshibwabwa & Teugels, 1995; Tshibwabwa, 1997).

  • Sinaseli M. Tshibwabwa, Melanie L. J. Stiassny, Robert C. Schelly (2006): Description of a new species of Labeo (Teleostei: Cyprinidae) from the lower Congo River. Zootaxa 1224, 33-44: 33-33, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:432790D3-8DEE-4499-816C-9C1963BAE14E
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Only known from the Mzima springs (Tsavo River system) (Seegers et al. unpub.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Possibly endemic to the Lower Tana system (Seegers et al. unpub.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Tana River drainage (Middle and Lower courses) (Seegers et al. unpub.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Four species of Labeo have been reported so far from the Nile basin, excluding Lake Victoria, i.e. Labeo niloticus ( Forskål , 1775) , L. horie Heckel, 1847 , L. coubie Rüppel , 1832 and L. forskalii Rüppel , 1835 (Heckel, 1847; Sandon, 1950; Abu-Gideiri, 1984; Bailey, 1994). In January 2006 during an ichthyological investigation on the River Nile in the Republic of Sudan a small Labeo species was found, similar in general appearance to L. ogunensis Boulenger, 1910 from West Africa. Morphometrics and meristics, however, soon revealed differences from every Labeo species described until know. Herein the new species L. meroensis is described using meristics, morphometrics and live coloration.

License not applicable

Timo Moritz

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
No information.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
No information.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
No information.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labeo cf. parvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. parvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Labeo cf. maleboensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. maleboensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Labeo cf. coubie

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTCATTCGAGCTGAGTTAAGCCAGCCCGGATCGCTTCTCGGCGATGACCAAATTTATAATGTTATCGTAACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCTGTCCTTATCGGAGGGTTTGGAAACTGACTCGTACCATTAATAATTGGAGCCCCAGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTCCTACCTCCATCATTCCTATTACTGCTAGCCTCTTCTGGTGTCGAAGCCGGGGCCGGAACAGGATGAACAGTATACCCACCTCTCGCAGGCAACTTAGCCCACGCAGGAGCATCAGTAGACCTGACAATTTTCTCGCTTCACTTAGCGGGGGTCTCATCAATTTTAGGGGCTATTAATTTTATTACTACAACCATTAATATAAAACCCCCAGCCATTTCACAATACCAAACACCCCTATTCGTCTGATCCGTGCTTGTAACCGCTGTACTACTTCTCCTATCGCTACCAGTACTGGCAGCGGGCATTACAATGCTTTTAACAGATCGAAATCTTAATACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. coubie

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Labeo cf. cyclorhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCCTAAGCCTCCTCATTCGAGCTGAATTAAGCCAACCCGGATCGCTTCTCGGTGACGACCAAATTTATAATGTTATCGTAACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTGTCCTTATTGGGGGATTTGGAAACTGACTTGTACCACTAATGATCGGAGCCCCGGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTACCCCCATCATTCCTACTATTACTAGCTTCTTCTGGTGTTGAGGCTGGAGCTGGGACAGGATGAACGGTATACCCACCTCTTGCAGGCAACTTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTCCACTTAGCAGGGGTCTCATCAATTTTAGGGGCCATTAATTTTATTACTACAACCATTAACATGAAGCCTCCAGCTATTTCACAATATCAAACACCCCTATTCGTTTGATCCGTACTTGTTACTGCCGTGCTGCTTCTCTTATCGCTGCCAGTACTGGCAGCGGGCATCACAATGCTTTTAACAGATCGAAATCTTAATACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. cyclorhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Labeo cf. boga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo cf. boga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 789
Specimens with Sequences: 933
Specimens with Barcodes: 709
Species: 59
Species With Barcodes: 57
Public Records: 367
Public Species: 42
Public BINs: 44
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2004

Assessor/s
Vreven, E.

Reviewer/s
Snoeks, J. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Programme)

Contributor/s

Justification
This species has a highly restricted distribution of the Mzima Springs, Tsavo, Kenya.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2004

Assessor/s
Vreven, E.

Reviewer/s
Snoeks, J. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Programme)

Contributor/s

Justification
Thought to be endemic to the lower Tana system (Seegers et al. unpublished). Assessed as Vulnerable on account of its restricted range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Vreven, E.

Reviewer/s
Snoeks, J. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Programme)

Contributor/s

Justification
Taxonomic uncertainty.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Labeo

This article is about the fish genus. For other uses, see Labeo (disambiguation).

Labeo is a genus of carps in the family Cyprinidae. They are found mainly in the Old World tropics.

It contains the typical labeos in the subfamily Labeoninae, which may not be a valid group, however, and is often included in the Cyprininae as tribe Labeonini. If the Labeoninae are accepted as distinct, Labeonini is the name of the tribe in this subfamily to which the labeos belong. If the Labeonini are considered a tribe of the Cyprininae, the labeos are placed in subtribe Labeoina.

The labeos appear fairly similar to the "freshwater sharks" of the genus Epalzeorhynchos, which is also part of the Labeoninae (or Labeonini), but is not very closely related. Labeos are larger, and have a more spindle-shaped body, as they are mostly free-swimming rather than benthic like Epalzeorhynchos. Their mouths look very different, too; they have a pronounced rostral cap, which covers the upper lip except when feeding. The lips are expanded into thick, sausage-shaped pads which have keratinized edges. Thus, their mouth parts are moderately apomorphic; not as little-developed as in barbs or in Epalzeorhynchos, but neither as extensive as in, for example, Garra or Ptychidio.[1] The genus name Labeo is Latin for "one who has large lips".[2]

Labeos have the two barbels on the rostrum which are common among the Cyprinidae, and also another pair of barbels at the rear edges of the lower maxilla, which has been lost in some of their relatives. They have a well-developed vomeropalatine organ. In the Weberian apparatus, the posterior supraneural bone is elongated and contacts the skull at the forward end.[1]

Species[edit]

There are currently 103 recognized species in this genus:[3]

References[edit]

  1. ^ a b Stiassny, M. L. and A. Getahun. (2007). An overview of labeonin relationships and the phylogenetic placement of the Afro-Asian genus Garra Hamilton, 1922 (Teleostei: Cyprinidae), with the description of five new species of Garra from Ethiopia, and a key to all African species. Zoological Journal of the Linnean Society 150(1), 41-83.
  2. ^ Froese, R. and D. Pauly. (Eds.) Labeo alluaudi. FishBase. 2011.
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Labeo in FishBase. December 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!