Overview

Comprehensive Description

Halichoeres Rueppell , 1835

Materials

Type status: Other material. Occurrence: recordedBy: Gabriela Martinez Portilla ; individualCount: 1 ; Location: continent: America; country: Mexico ; stateProvince: Yucatan; locality: Madagascar Reef ; verbatimLatitude: 781272.611854; verbatimLongitude: 2373443.69326; verbatimCoordinateSystem: UTM 15N; verbatimSRS: WGS84; decimalLatitude: 21.441469 ; decimalLongitude: -90.286290 ; Event: samplingProtocol: Visual census ; eventDate: 13/5/2005

Distribution

Worldwide.

Notes

Occurrence reported by Martínez de la Portilla (2008) .

  • Zarco Perello, Salvador, Moreno Mendoza, Rigoberto, Simoes, Nuno (2014): Checklist of Fishes from Madagascar Reef, Campeche Bank, Mexico. Biodiversity Data Journal 2, 1100: 1100-1100, URL:http://dx.doi.org/10.3897/BDJ.2.e1100
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This large genus includes eleven regional species, two of which have only recently been discovered (H. socialis from mangrove habitats in Belize (Randall and Lobel 2003) and H. burekae from deep reefs in the Gulf of Mexico (Weaver and Rocha 2007)). In addition, the northern (coastal USA) population of H. bivittatus is genetically divergent and represents a cryptic species. The phylogeny of the genus is presently in flux and it is likely that it will be split into three, or perhaps many more, genera (there are numerous unrelated lineages in the Indo-Pacific). Most Caribbean species share a basic fin-ray count of D-IX,11 A-III,12 and Pect-13 (H. maculipinna and H. cyanocephalus have slightly differing fin-ray counts).

My DNA-sequence analysis reveals that there is a large clade of Atlantic Halichoeres made up of H. bivittatus, H. garnoti, H. poeyi, H. radiatus, and H. cyanocephalus (and its Brazilian sibling H. dimidiatus). There is a smaller related clade made up of H. pictus and H. socialis (along with the eastern Pacific H. dispilus and H. insularis). My results confirm that H. maculipinna falls out well away from the other Halichoeres and nearer to Thalassoma (Barber and Bellwood 2005).

The larvae of a number of Halichoeres overlap in appearance and DNA sequencing is necessary to confirm the species for those larvae. The species do become distinct as they develop juvenile markings. The size at settlement for this genus is quite consistent, around 10-12 mm (interestingly, one eastern Pacific sibling, H. insularis, settles much larger, up to 22 mm SL). An unusual aspect of the early life history of these labrids is that larvae undergoing transition are not captured in pelagic sampling, but are found buried in sand and rubble on reefs. This attribute is shared with Thalassoma bifasciatum, but not with Doratonotus megalepis or the related parrotfishes, both of which begin transition while still pelagic and transitional larvae are commonly caught in nearshore collections. Interestingly, I did collect one transitional larva of H. poeyi at a nightlight in Panama and it was the single largest Halichoeres larvae out of many hundreds collected, i.e. 13.8 mm SL.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2039 specimens in 75 taxa.
Water temperature and chemistry ranges based on 1166 samples.

Environmental ranges
  Depth range (m): 0 - 582
  Temperature range (°C): 10.506 - 29.336
  Nitrate (umol/L): 0.002 - 27.326
  Salinity (PPS): 32.019 - 40.307
  Oxygen (ml/l): 1.197 - 6.036
  Phosphate (umol/l): 0.006 - 2.103
  Silicate (umol/l): 0.567 - 57.654

Graphical representation

Depth range (m): 0 - 582

Temperature range (°C): 10.506 - 29.336

Nitrate (umol/L): 0.002 - 27.326

Salinity (PPS): 32.019 - 40.307

Oxygen (ml/l): 1.197 - 6.036

Phosphate (umol/l): 0.006 - 2.103

Silicate (umol/l): 0.567 - 57.654
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:985
Specimens with Sequences:943
Specimens with Barcodes:887
Species:61
Species With Barcodes:61
Public Records:568
Public Species:56
Public BINs:70
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Halichoeres sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATATAGTATTCGGAGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTATTAATTCGAGCTGAATTAAGCCAGCCCGGTGCTCTCCTCGGAGACGACCAAATCTACAATGTTATCGTTACAGCCCACGCTTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATCGGTGGGTTCGGAAATTGACTGATTCCTCTAATGATTGGAGCACCTGACATGGCCTTCCCTCGAATGAACAACATGAGTTTTTGACTTCTTCCCCCCTCCTTCCTTCTTCTCCTTGCATCTTCAGGGGTAGAAGCTGGGGCCGGGACTGGCTGAACAGTATATCCCCCCTTGGCAGGAAACCTAGCCCACGCCGGAGCCTCAGTAGACCTCACTATCTTTTCCCTCCACTTAGCCGGAATTTCATCTATTCTAGGGGCAATTAACTTTATTACAACAATTATTAACATAAAACCTCCGGCCATTTCCCAATATCAAACACCCCTTTTTGTCTGAGCCGTGCTCATTACAGCAGTTCTTCTTCTCCTCTCTCTTCCCGTCCTAGCTGCTGGTATTACCATGCTCCTAACAGATCGAAACCTAAACACAACCTTCTTTGACCCTGCTGGAGGAGGTGATCCGATTCTATACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halichoeres

Halichoeres is a genus of wrasses found in the Atlantic, Indian and Pacific Oceans.[1]

Species[edit]

The 81 currently recognized species in this genus are:[1][2]

References[edit]

  1. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2013). Species of Halichoeres in FishBase. August 2013 version.
  2. ^ Victor, B.C., Alfaro, M.E. & Sorenson, L. (2013): Rediscovery of Sagittalarva inornata n. gen., n. comb. (Gilbert, 1890) (Perciformes: Labridae), a long-lost deepwater fish from the eastern Pacific Ocean: a case study of a forensic approach to taxonomy using DNA barcoding. Zootaxa, 3669 (4): 551–570.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!