Ecology
Habitat
Depth range based on 2039 specimens in 75 taxa.
Water temperature and chemistry ranges based on 1166 samples.
Environmental ranges
Depth range (m): 0 - 582
Temperature range (°C): 10.506 - 29.336
Nitrate (umol/L): 0.002 - 27.326
Salinity (PPS): 32.019 - 40.307
Oxygen (ml/l): 1.197 - 6.036
Phosphate (umol/l): 0.006 - 2.103
Silicate (umol/l): 0.567 - 57.654
Graphical representation
Depth range (m): 0 - 582
Temperature range (°C): 10.506 - 29.336
Nitrate (umol/L): 0.002 - 27.326
Salinity (PPS): 32.019 - 40.307
Oxygen (ml/l): 1.197 - 6.036
Phosphate (umol/l): 0.006 - 2.103
Silicate (umol/l): 0.567 - 57.654
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1166 samples.
Environmental ranges
Depth range (m): 0 - 582
Temperature range (°C): 10.506 - 29.336
Nitrate (umol/L): 0.002 - 27.326
Salinity (PPS): 32.019 - 40.307
Oxygen (ml/l): 1.197 - 6.036
Phosphate (umol/l): 0.006 - 2.103
Silicate (umol/l): 0.567 - 57.654
Graphical representation
Depth range (m): 0 - 582
Temperature range (°C): 10.506 - 29.336
Nitrate (umol/L): 0.002 - 27.326
Salinity (PPS): 32.019 - 40.307
Oxygen (ml/l): 1.197 - 6.036
Phosphate (umol/l): 0.006 - 2.103
Silicate (umol/l): 0.567 - 57.654
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Halichoeres sp.
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTTTATATAGTATTCGGAGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTATTAATTCGAGCTGAATTAAGCCAGCCCGGTGCTCTCCTCGGAGACGACCAAATCTACAATGTTATCGTTACAGCCCACGCTTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATCGGTGGGTTCGGAAATTGACTGATTCCTCTAATGATTGGAGCACCTGACATGGCCTTCCCTCGAATGAACAACATGAGTTTTTGACTTCTTCCCCCCTCCTTCCTTCTTCTCCTTGCATCTTCAGGGGTAGAAGCTGGGGCCGGGACTGGCTGAACAGTATATCCCCCCTTGGCAGGAAACCTAGCCCACGCCGGAGCCTCAGTAGACCTCACTATCTTTTCCCTCCACTTAGCCGGAATTTCATCTATTCTAGGGGCAATTAACTTTATTACAACAATTATTAACATAAAACCTCCGGCCATTTCCCAATATCAAACACCCCTTTTTGTCTGAGCCGTGCTCATTACAGCAGTTCTTCTTCTCCTCTCTCTTCCCGTCCTAGCTGCTGGTATTACCATGCTCCTAACAGATCGAAACCTAAACACAACCTTCTTTGACCCTGCTGGAGGAGGTGATCCGATTCTATACCAACATCTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Halichoeres sp.
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 886 | Public Records: | 543 |
| Specimens with Sequences: | 830 | Public Species: | 56 |
| Specimens with Barcodes: | 775 | Public BINs: | 67 |
| Species: | 61 | ||
| Species With Barcodes: | 58 | ||
© Barcode of Life Data Systems
Trusted
Barcode data
© Barcode of Life Data Systems
Trusted
Locations of barcode samples
© Barcode of Life Data Systems
Trusted
Wikipedia
Halichoeres
The wrasse genus Halichoeres includes among others the ray-finned fish collectively called yellow wrasses.
- Halichoeres adustus (Gilbert, 1890), Black wrasse
- Halichoeres aestuaricola (Bussing, 1972), Mangrove wrasse
- Halichoeres argus (Bloch & Schneider, 1801), Argus wrasse
- Halichoeres bathyphilus (Beebe & Tee-Van, 1932), Greenband wrasse
- Halichoeres bicolor (Bloch & Schneider, 1801)
- Halichoeres binotopsis (Bleeker, 1849)
- Halichoeres biocellatus (Schultz, 1960), Red-lined wrasse
- Halichoeres bivittatus (Bloch, 1791), Slippery dick
- Halichoeres bleekeri (Steindachner & Döderlein, 1887)
- Halichoeres brasiliensis (Bloch, 1791), Brazilian wrasse
- Halichoeres brownfieldi (Whitley, 1945), Brownfields wrasse
- Halichoeres burekae Weaver & Rocha, 2007, Mardi Gras wrasse
- Halichoeres caudalis (Poey, 1860), Painted wrasse
- Halichoeres chierchiae (Di Caporiacco, 1948), Wounded wrasse
- Halichoeres chlorocephalus (Kuiter & Randall, 1995)
- Halichoeres chloropterus (Bloch, 1791), Pastel-green wrasse
- Halichoeres chrysus (Randall, 1981), Canary wrasse
- Halichoeres cosmetus (Randall & Smith, 1982), Adorned wrasse
- Halichoeres cyanocephalus (Bloch, 1791), Yellowcheek wrasse
- Halichoeres dimidiatus (Agassiz, 1831)
- Halichoeres discolor (Bussing, 1983), Cocos wrasse
- Halichoeres dispilus (Günther, 1864), Chameleon wrasse
- Halichoeres garnoti (Valenciennes, 1839), Yellowhead wrasse
- Halichoeres girardi (Bleeker, 1859)
- Halichoeres hartzfeldii (Bleeker, 1852), Hartzfeld's wrasse
- Halichoeres hortulanus (Lacepède, 1801), Checkerboard wrasse
- Halichoeres insularis (Allen & Robertson, 1992), Socorro wrasse
- Halichoeres iridis (Randall & Smith, 1982)
- Halichoeres kallochroma (Bleeker, 1853)
- Halichoeres lapillus (Smith, 1947), Jewelled wrasse
- Halichoeres leptotaenia (Randall & Earle, 1994)
- Halichoeres leucoxanthus (Randall & Smith, 1982), Whitebelly wrasse
- Halichoeres leucurus (Walbaum, 1792), Greyhead wrasse
- Halichoeres maculipinna (Müller & Troschel, 1848), Clown wrasse
- Halichoeres malpelo (Allen & Robertson, 1992), Malpelo wrasse
- Halichoeres margaritaceus (Valenciennes, 1839), Pink-belly wrasse
- Halichoeres marginatus (Rüppell, 1835), Dusky wrasse
- Halichoeres melanochir (Fowler & Bean, 1928)
- Halichoeres melanotis (Gilbert, 1890), Golden wrasse
- Halichoeres melanurus (Bleeker, 1851), Tail-spot wrasse
- Halichoeres melas (Randall & Earle, 1994)
- Halichoeres melasmapomus (Randall, 1981), Cheekspot wrasse
- Halichoeres miniatus (Valenciennes, 1839), Circle-cheek wrasse
- Halichoeres nebulosus (Valenciennes, 1839), Nebulous wrasse
- Halichoeres nicholsi (Jordan & Gilbert, 1882), Spinster wrasse
- Halichoeres nigrescens (Bloch & Schneider, 1801), Bubblefin wrasse
- Halichoeres notospilus (Günther, 1864), Banded wrasse
- Halichoeres orientalis (Randall, 1999)
- Halichoeres ornatissimus (Garrett, 1863), Ornamented wrasse
- Halichoeres pallidus (Kuiter & Randall, 1995), Pale wrasse
- Halichoeres papilionaceus (Valenciennes, 1839)
- Halichoeres pardaleocephalus (Bleeker, 1849)
- Halichoeres pelicieri (Randall & Smith, 1982)
- Halichoeres penrosei (Starks, 1913)
- Halichoeres pictus (Poey, 1860), Rainbow wrasse
- Halichoeres podostigma (Bleeker, 1854), Axil spot wrasse
- Halichoeres poeyi (Steindachner, 1867), Blackear wrasse
- Halichoeres prosopeion (Bleeker, 1853), Twotone wrasse
- Halichoeres purpurescens (Bloch & Schneider, 1801), Silty wrasse
- Halichoeres radiatus (Linnaeus, 1758), Puddingwife wrasse
- Halichoeres raisneri (Baldwin & McCosker, 2001)
- Halichoeres richmondi (Fowler & Bean, 1928), Richmond's wrasse
- Halichoeres rubricephalus (Kuiter & Randall, 1995)
- Halichoeres salmofasciatus (Allen & Robertson, 2002)
- Halichoeres sazimai
- Halichoeres scapularis (Bennett, 1832), Zigzag wrasse
- Halichoeres semicinctus (Ayres, 1859), Rock wrasse
- Halichoeres signifer (Randall & Earle, 1994)
- Halichoeres socialis (Randall & Lobel, 2003)
- Halichoeres solorensis (Bleeker, 1853), Green wrasse
- Halichoeres stigmaticus (Randall & Smith, 1982), U-spot wrasse
- Halichoeres tenuispinis (Günther, 1862)
- Halichoeres timorensis (Bleeker, 1852), Timor wrasse
- Halichoeres trimaculatus (Quoy & Gaimard, 1834), Threespot wrasse
- Halichoeres trispilus (Randall & Smith, 1982), Banana Wrasse
- Halichoeres vrolikii (Bleeker, 1855), Indian Ocean pinstriped wrasse
- Halichoeres zeylonicus (Bennett, 1833), Goldstripe wrasse
References
- ^ Froese, Rainer, and Daniel Pauly, eds. (2007). "Halichoeres " in FishBase. 8 2007 version.
 | Wikispecies has information related to: Halichoeres |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
