Ecology

Habitat

Depth range based on 8680 specimens in 16 taxa.
Water temperature and chemistry ranges based on 6732 samples.

Environmental ranges
  Depth range (m): 0.5 - 956
  Temperature range (°C): 4.175 - 26.803
  Nitrate (umol/L): 0.090 - 33.558
  Salinity (PPS): 34.382 - 36.031
  Oxygen (ml/l): 3.772 - 5.662
  Phosphate (umol/l): 0.078 - 1.914
  Silicate (umol/l): 0.600 - 50.515

Graphical representation

Depth range (m): 0.5 - 956

Temperature range (°C): 4.175 - 26.803

Nitrate (umol/L): 0.090 - 33.558

Salinity (PPS): 34.382 - 36.031

Oxygen (ml/l): 3.772 - 5.662

Phosphate (umol/l): 0.078 - 1.914

Silicate (umol/l): 0.600 - 50.515
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:271Public Records:158
Specimens with Sequences:204Public Species:22
Specimens with Barcodes:195Public BINs:24
Species:23         
Species With Barcodes:23         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus cf. endrachtensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Platycephalus cf. indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTATCTAGTATTCGGTGCCTGAGCCGGGATAGTAGGAACCGCCCTAAGCCTACTCATTCGAGCTGAACTCAGCCAACCCGGCGCTTTACTGGGAGATGACCAAATCTATAACGTTATCGTTACAGCCCATGCCTTTGTAATAATTTTCTTCATGGTTATACCAATTATGATCGGCGGCTTCGGCAACTGACTAATCCCCTTAATAATTGGTGCACCAGACATGGCATTCCCCCGAATAAATAACATAAGTTTCTGACTATTACCCCCGTCCTTCCTACTTCTCCTAGCCTCCTCCGCCGTAGAAGCCGGGGCAGGGACCGGATGAACAGTCTACCCGCCCCTGTCAAGCAACCTGGCCCATGCAGGAGCCTCTGTCGACCTAACAATCTTCTCCCTACATTTGGCGGGAATTTCCTCAATTCTTGGGGCCATCAACTTCATTACTACCATTATTAACATGAAACCCATTGCTATTACTCAGTACCAAACACCCCTGTTCGTTTGATCAGTCCTAATCACAGCTGTTCTCCTTCTCCTCTCCCTGCCGGTTCTGGCTGCCGGCATCACAATGCTACTCACAGACCGAAACCTAAACACCACCTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTATACCAACATCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus cf. indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus sp. 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Platycephalus sp. 1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus sp. (Borneo)

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Platycephalus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTCTATCTAGTATTCGGTGCCTGAGCCGGAATGGTGGGCACCGCCCTAAGCCTGCTCATCCGAGCGGAACTCTGCCAACCCGGCGCTTTACTAGGCGACGATCAAATCTATAATGTGATCGTCACAGCTCATGCCTTTGTAATAATCTTCTTTATAGTGATACCAATTATGATCGGCGGCTTCGGCAACTGGCTGATCCCCCTAATAATTGGCGCGCCAGACATGGCGTTTCCTCGAATAAATAACATAAGCTTCTGACTCCTACCTCCATCCTTCCTGCTCCTCCTAGCCTCGTCGGCTGTAGAAGCTGGGGCAGGTACCGGATGAACAGTCTACCCACCCCTGTCAAGTAATCTTGCCCACGCAGGAGCCTCTGTTGATTTAACAATTTTTTCACTACATTTAGCAGGAATCTCTTCAATTCTGGGGGCCATCAACTTCATTACAACCATCATTAACATGAAACCTATTGCTATTACTCAATACCAGACCCCCCTCTTCGTGTGGTCCGTTCTGATTACGGCTGTCCTCCTTCTCCTCTCCCTGCCTGTCCTAGCTGCTGGCATTACAATGCTACTAACAGACCGAAATCTAAACACCACCTTCTTTGACCCTGCAGGAGGGGGGGACCCAATCCTGTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Platycephalus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Platycephalus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Platycephalus

Platycephalus is a genus of mostly-marine, bottom-dwelling fish in the family Platycephalidae.

Contents

Etymology and Taxonomic History[edit]

The name of the genus, Platycephalus is derived from the Greek words for "flat" and "head". This quite literally describes the major morphological distinguishing characteristic of the members of the genus (and the family).

The Common snook (Centropomus undecimalis) was originally described as Platycephalus undecimalis. It has since been recognized as being a perciform fish belonging in the family Centropomidae.

Species[edit]

There are currently 17 recognized species in this genus:[3]

References[edit]

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. Retrieved 2007-12-25. 
  2. ^ "Scorpaeniformes". Paleobiology Database. Retrieved November 15, 2012. 
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Platycephalus in FishBase. December 2012 version.

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!