Ecology

Habitat

Depth range based on 225 specimens in 49 taxa.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 21.311 - 29.128
  Nitrate (umol/L): 0.143 - 0.144
  Salinity (PPS): 33.956 - 34.228
  Oxygen (ml/l): 4.582 - 5.074
  Phosphate (umol/l): 0.213 - 0.352
  Silicate (umol/l): 2.882 - 3.264

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 21.311 - 29.128

Nitrate (umol/L): 0.143 - 0.144

Salinity (PPS): 33.956 - 34.228

Oxygen (ml/l): 4.582 - 5.074

Phosphate (umol/l): 0.213 - 0.352

Silicate (umol/l): 2.882 - 3.264
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Fundulus (Fundulus, fish fry) is prey of:
Clupea
Scomber
Loligo
Pomatomus
Sterna
Megaceryle

Based on studies in:
USA: Massachusetts, Cape Ann (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 272 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 284 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Fundulus (Fundulus, fish fry) preys on:
plankton
detritus
suspended organic matter
Acmaea
Crepidula
Littorina saxatilis
Littorina littorea
Littorina obtusata
Mytilus
Balanus
Clava
Obelia
Sertularia
Metridium
Gammarus
Orchestia
ThAsterias
Carcinides
Cancer
Anurida
Melampus
Philoscia
Cylisticus

Based on studies in:
USA: Massachusetts, Cape Ann (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 272 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 278 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 284 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 287 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 288 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fundulus cf. grandis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGTATAGTAGGTACAGCTCTTAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCTCTCTTCTAGGGGATGACCAAATTTATAATGTAATCGTTACAGCACATGCATTTGTAATAATCTTTTTTATAGTTATACCAATCATAATTGGAGGTTTTGGAAATTGACTAATTCCTCTTATAATTGGTGCTCCAGACATAGCTTTTCCTCGTATAAATAATATAAGCTTCTGACTTCTTCCACCGTCATTTTTACTTCTCTTAGCCTCTTCTGGTGTTGAAGCCGGGGCTGGGACGGGTTGAACAGTTTATCCCCCCTTGGCAGGTAATTTAGCTCATGCAGGGGCTTCAGTAGATTTAACGATTTTTTCCCTACACTTGGCTGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACCACTATTATTAACATAAAACCTCCAGCTATTTCCCAATACCAGACCCCTCTGTTCGTATGAGCCGTCCTGATTACTGCTGTACTTCTTCTACTCTCCTTACCAGTCCTTGCTGCAGGAATCACAATGCTACTAACTGACCGAAATTTAAATACTACATTTTTTGACCCGGCAGGTGGAGGGGATCCTATTCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fundulus cf. grandis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:363Public Records:152
Specimens with Sequences:285Public Species:26
Specimens with Barcodes:282Public BINs:21
Species:39         
Species With Barcodes:36         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Fundulus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fundulus

Fundulus is a genus of ray-finned fishes in the superfamily Funduloidea, family Fundulidae (of which it is the type genus). It belongs to the order of toothcarps (Cyprinodontiformes), and therein the large suborder Cyprinodontoidei. Most of its closest living relatives are egg-laying, with the notable exception of the splitfin livebearers (Goodeidae).

They are usually smallish; most species reaching a length of at most 4 in (10 cm) when fully grown. However, a few larger species exist, with the giant killifish (F. grandissimus) and the northern studfish (F. catenatus) growing to twice the genus' average size.

Many of the 40-odd species are commonly known by the highly ambiguous name "killifish" (the general term for egg-laying toothcarps), or the somewhat less ambiguous "topminnow" (a catch-all term for Fundulidae). "Studfish" is a quite unequivocal vernacular name applied to some other Fundulus species; it is not usually used to refer to the genus as a whole, however.

Species

Russetfin Topminnow (F. escambiae)

There are currently 39 recognized species in this genus: [1]

Formerly placed in Fundulus were the closely related diamond killifish (Adinia xenica) and the somewhat more distantly related Cuban killifish (Cubanichthys cubensis, a pupfish).

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Fundulus in FishBase. August 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!