Overview

Brief Summary

Biology

Zooxanthellate and azooxanthellate species
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fossil species

recent & fossil

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 270 specimens in 26 taxa.
Water temperature and chemistry ranges based on 191 samples.

Environmental ranges
  Depth range (m): 1.75 - 1050
  Temperature range (°C): 4.792 - 27.668
  Nitrate (umol/L): 0.176 - 41.048
  Salinity (PPS): 34.478 - 36.531
  Oxygen (ml/l): 1.201 - 6.172
  Phosphate (umol/l): 0.027 - 3.016
  Silicate (umol/l): 0.774 - 64.551

Graphical representation

Depth range (m): 1.75 - 1050

Temperature range (°C): 4.792 - 27.668

Nitrate (umol/L): 0.176 - 41.048

Salinity (PPS): 34.478 - 36.531

Oxygen (ml/l): 1.201 - 6.172

Phosphate (umol/l): 0.027 - 3.016

Silicate (umol/l): 0.774 - 64.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

0-1050 m
  • Roberts, J.M., A. Wheeler, A. Freiwald, and S.D. Cairns, 2009. Cold-Water Corals: The Biology and Geology of Deep-Sea Coral Habitats. Cambridge University Press, Cambridge. 334 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 11
Specimens with Sequences: 11
Specimens with Barcodes: 11
Species: 4
Species With Barcodes: 4
Public Records: 10
Public Species: 4
Public BINs: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oculina sp. TLS-2004

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTAGTCTTTGGTGTTGGGGCAGGGCTAATTGGGACTGCTTTTAGTATGCTTATACGACTGGAGCTTTCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTCTTTTTAGTAATGCCGGTTATGATTGGGGGATTTGGAAACTGGTTGGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTGTTACCGCCTGCTTTGCTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGTGCAGGAACGGGATGGACGGTTTATCCTCCTCTTTCTGATATTTATGCTCATTCTGGGGGTTCTGTTGATATGGTTATCTTTAGTCTTCATTTAGCTGGGGTTTCTTCTATCTTAGGAGCAATAAATTTTATTACAACGATTTTTAATATGCGAGCTCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCGTTTTTATTGCTTTTATCTTTGCCTGTATTAGCGGGTGCAATCACTATGTTGTTAACAGATCGAAATTTTAAHACAACTTTTTTTGATCCTTCTGGGGGTGGAGATCCTATTTTATTCCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oculina sp. TLS-2004

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oculina

Oculina is a genus of colonial stony coral in the family Oculinidae. These corals are mostly found in the Caribbean Sea, the Gulf of Mexico and Bermuda [2] but some species occur in the east Pacific Ocean. They occur at depths down to 1000 metres.[1]

Description

The colonies of Oculina have a straggly branching structure and are mostly pale yellow. The branches are slim, not exceeding 1 centimetre (0.39 in) in diameter. The corallites which house the polyps are widely separated. Their walls are composed of fragile, solid-walled tubes. Each corallite has 12 primary septae with fine teeth which partially project from the corallite wall and which are larger than the intermediate septae. Some species contain symbiotic microalgae called zooxanthellae.[2]

Species

The World Register of Marine Species lists the following species:[1]

References

  1. ^ a b c WoRMS (2010). "Oculina Lamarck, 1816". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=135124. Retrieved 2011-12-15.
  2. ^ a b Family Oculinidae: Oculina Horizon. Retrieved 2011-12-15.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!