Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The Indo-Pacific sailfish, Istiophorus platypterus, is a large oceanic fish native to the tropical and temperate Indian and Pacific Oceans, one of eleven species in the small marlin family Istiophoridae. Recent research has shown the Atlantic sailfish (Istiophorus albicans) and Indo-Pacific sailfish are subspecies of the same world-wide species, although they do not interbreed. Indo-Pacific sailfish have been recorded in size up to 3.4 meters long and weighing 100 kg; they live up to four years. One of the world’s fastest fish, these cheetahs of the ocean are able to sprint for short distances at 110 km/hour. They hunt their main food source, schooling fish (mackerel, sardines and the like), by chasing them down, then turn suddenly in front of the school to stun or kill them with their long bill and pick their prey out of the water column. Sometimes this hunting is done cooperatively in schools with other like-sized sailfish. Indo-Pacific sailfish are opportunistic feeders and have been reported to eat more unusual prey such as pufferfish and toadfish species, as well as invertebrates such as crustaceans and cephalopods. Their large, erectile dorsal fin helps sailfish to herd their prey and it is folded back during periods of fast swimming. Females also attract mates by extending her dorsal fin out of the water surface, and it is thought that the fin may also play a role in temperature regulation. Indo-Pacific sailfish regularly come in close to shore, reefs and islands. Sailfish are a popular sport fish. They are caught commercially, although their flesh is considered tough and not great eating, and also caught as by-catch in tuna longlines. Sailfish are abundant in their range and their populations are considered stable, although many agencies work to protect and to regulate fishing of this species (including The Billfish Foundation).

(ARKive; Collette et al. 2006; FAO factsheet; McGrouther 2011; National Geographic animals/; Wikipedia 2011)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Common names: sailfish (English), pez-vela (Espanol)
 
Istiophorus platypterus (Shaw in Shaw & Nodder, 1792)


Sailfish


Body fairly compressed; bill long, slender, rounded in cross section; adults with small teeth; 1st  dorsal long based, sail like, much higher than body depth, close to 2nd  dorsal, 1st  42-49 rays, 2nd  6-7 rays; pectorals long and pointed, 18-20 rays; pelvic fins very long, depressible into a groove, reach almost to anus; 2 anal fins, 1st  12-17 rays, 2nd  6-7 rays; 2 keels on side of tail base; tail fin large, strongly forked; body covered with small, triangular scales.


Dark blue dorsally, light blue blotched with brown laterally, and silvery white ventrally; ~ 20 rows of vertical bars on sides, each composed of many light blue round spots; membrane of first dorsal fin dark blue or blackish blue, with scattered, small black spots; remaining fins blackish brown to dark blue.

Size: grows to 360 cm; all-tackle world record 100.24 Kg.

Habitat: coastal and oceanic pelagic.

Depth: 0-30 m.

Circumtropical in tropical and temperate seas; southern California to the lower 3/4 of the Gulf of California to Peru and the oceanic islands.

Note: Other than the fact that Indo-Pacific fish reach a larger size than Atlantic fish (100kg vs 60kg) there are no morphological differences between the two (see Collette et al 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Oceanic and epipelagic species usually found above the thermocline. Most densely distributed in waters close to coasts and islands (Ref. 9688). Most likely schools by size. Undergoes spawning migrations in the Pacific (Ref. 43). Feeds mainly on fishes, crustaceans and cephalopods. Utilized fresh, smoked and frozen; also used for sashimi and sushi; eaten broiled and baked (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

In the Indian and Pacific oceans, this species occurs between approximately 45.5°N and 40.35°S in the western Pacific, 35°N and 35°S in the eastern Pacific, 45°S in the western Indian Ocean and 35°S in eastern Indian Ocean.

In the Eastern Pacific, this species is found from southern California and the lower three-fourths of the Gulf of California to Peru, including all of the oceanic islands.

This species is found in tropical and temperate waters approximately 40°N in the northwest Atlantic, 50°N in the northeast Atlantic, 40°S in the southwest Atlantic, and 32°S in the southeast Atlantic. It has entered the Mediterranean Sea from the Red Sea via the Suez Canal.

In both the eastern tropical Pacific and the eastern tropical Atlantic, sailfish concentrate in shallower waters than in the western part of both oceans due to hypoxia-based habitat compression over oxygen minimum zones in the eastern tropical seas (Prince et al. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Virginian, south side of Cape Cod to Cape Hatteras
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North Pacific, North West Atlantic, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: tropical and temperate waters approximately 45°- 50°N and 40°-35°S in the western Pacific, 35°N and 35°S in the eastern Pacific; 45°S in western Indian Ocean and 35°S in eastern Indian Ocean. Entered Mediterranean Sea from Red sea via Suez Canal. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139). Some authors recognize a single worldwide species, Istiophorus platypterus (Shaw & Nodder 1792) but we follow Nakamura 1990 (Ref. 10820) retaining the usage of Istiophorus platypterus for the Indo-Pacific sailfish and Istiophorus albicans for the Atlantic sailfish in recognition of the differences between them.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 47 - 53; Analspines: 2; Analsoft rays: 12 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 360.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

348 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 100.2 kg (Ref. 40637); max. reported age: 13 years (Ref. 53742)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Oceanic, epipelagic and highly migratory species usually found above the thermocline. Most densely distributed in waters close to coasts and islands (Ref. 9688). Most likely schools by size. Known to be migratory (Ref. 9308). Feeds mainly on fishes, crustaceans and cephalopods. This species is very similar to @I. albicans@. Also caught with long lines, set nets, troll lines and harpoons (Ref. 9308). Utilized fresh, smoked and frozen; also used for sashimi and sushi; eaten broiled and baked (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body elongate and compressed; upper jaw prolonged into a very long beak; two dorsal fins, the first very large and tail; pelvic fins narrow but very long, almost reaching anus, with 1 spine and 2 rays; body covered with small, embedded scales with 1 or 2 blunt points; back dark with about 20 bluish vertical bars; belly pale silver; membrane of first dorsal fin blue black with numerous dark spots (Ref. 55763). A slender billfish with a high, sail-like first dorsal fin (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This oceanic and epipelagic species is usually found above the thermocline to depths of 40 m. It is most densely distributed in waters close to coasts and islands. This species occasionally forms schools or smaller groups of 3–30 individuals but often occurs in loose aggregations over a wide area. It most likely schools by size. This species undergoes spawning migrations in the Pacific (Nakamura 1985), and feeds mainly on fishes, crustaceans, and cephalopods.

Appears to spawn throughout the year in tropical and subtropical waters of the Pacific with peak spawning occurring in the respective local summer seasons. Spawning occurs with males and females swimming in pairs or with two or three males chasing a single female (probably a mating behaviour). Around Florida in the USA, this species often moves inshore into shallow waters where females, swimming sluggishly with their dorsal fins extended and accompanied each by one or more males, may spawn near the surface in the warm season. However, spawning in offshore waters beyond the 100 fathom isobath was also reported from south of Cuba to Carolina, USA. Off southeast Florida, a 33.4 kg female may shed up to 4.8 million eggs in three batches during one spawning season.

This species has a fast growth rate. Using the best available data, longevity is estimated to be 13 years and age of maturity 2.5 years (Prince et al. 1986, Ortiz et al. 2003, IUCN SSC Tuna and Billfishes Specialist Group). No external sexual dimorphism, but females grow larger than males. Fecundity increases sharply with size of the female (Nakamura 1985, de Sylva and Breder 1997, Richards and Luthy 2005, Chiang et al. 2006, Wang et al. 2006). Using a longevity of 13 years and age of maturity of 2.5 years, the generation length was estimated to be 4.3 years. The generation length is calculated as: age of first reproduction + z * (longevity - age of first maturity), where z is 0.15 (Collette et al. 2011).

Sailfish grow larger in the Pacific than in the Atlantic. The all-tackle game fish record in the Pacific is of a 100.24 kg fish caught off Santa Cruz Island, Ecuador in 1947 while the largest sailfish from the Atlantic was only 64 kg and was caught off Luanda, Angola in 1994 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 8.5
  Temperature range (°C): 23.937 - 24.777
  Nitrate (umol/L): 0.381 - 0.499
  Salinity (PPS): 34.963 - 35.976
  Oxygen (ml/l): 4.770 - 4.865
  Phosphate (umol/l): 0.096 - 0.233
  Silicate (umol/l): 1.044 - 2.391

Graphical representation

Depth range (m): 0 - 8.5

Temperature range (°C): 23.937 - 24.777

Nitrate (umol/L): 0.381 - 0.499

Salinity (PPS): 34.963 - 35.976

Oxygen (ml/l): 4.770 - 4.865

Phosphate (umol/l): 0.096 - 0.233

Silicate (umol/l): 1.044 - 2.391
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 200 m (Ref. 54238), usually 30 - ? m (Ref. 9688)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Abundance and distribution is correlated with the seasonal movements of the water isotherm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Seems to spawn throughout the year in tropical and subtropical waters of the Pacific with peak spawning occurring in the respective local summer seasons. Spawning occurs with males and females swimming in pairs or with two or three males chasing a single female (probably a mating behavior). The ripe ovarian eggs are about 0.85 mm in diameter and have a single oil globule; there are no structures on the vitalize membrane and the egg is transparent. Eggs shed from captured female in the Indian Ocean averaged 1.304 mm in diameter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Istiophorus platypterus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC8162-09|AB470306|Istiophorus platypterus| ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCCCTG---AGCCTTCTAATTCGAGCTGAACTTAGCCAACCTGGCGCTTTACTAGGCGAT---GATCAAATTTATAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTCGGAAACTGACTGATTCCTCTAATG---ATCGGAGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTACTCCCTCCCTCATTCCTTCTACTCCTCGCCTCCTCCGGGGTTGAAGCCGGAGCCGGTACAGGATGAACCGTCTACCCCCCTCTAGCAGGAAACCTAGCCCACGCAGGAGCATCTGTTGACCTA---ACTATTTTCTCCCTCCACCTAGCTGGTATTTCTTCCATCTTAGGAGCTATCAACTTTATCACTACCATCATTAACATGAAACCAGCTGCCGTTTCAATGTACCAGATCCCCCTATTCGTCTGAGCAGTACTGATTACAGCTGTCCTTCTACTCCTTTCTCTACCCGTCCTAGCTGCT---GGAATCACAATGCTTCTCACGGATCGTAATCTTAACACTGCCTTCTTCGACCCAGCCGGGGGTGGTGACCCAATCCTTTATCAACACCTATTCTGATTCTTTGGGCACCCAGAGGTTTATATTCTTATTCTACCAGGTTTCGGAATGATCTCCCATATTGTTGCCTACTATTCTGGCAAAAAA---GAACCTTTCGGCTATATGGGTATGGTCTGAGCTATGATGGCTATTGGCCTTCTAGGCTTCATTGTCTGAGCCCATCACATGTTCACAGTCGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Istiophorus platypterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Species: 52
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Nelson, R., Oxenford, H., Restrepo, V., Salas, E., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B., Elfes, C. & Polidoro, B.

Contributor/s

Justification
This species is widespread in the Atlantic and Indo-Pacific, and is common. It is primarily caught in sport and artisanal fisheries, and as bycatch in long-line and purse seines. There have been some localized declines, such as in Central America and in Iran and India, but there are no stock assessments, and landings and effort data are not reliable as catch statistics for this species are generally aggregated with other species. However, there is not currently any indication of widespread decline. It is therefore listed as Least Concern. Better reporting of catch and effort is needed to adequately assess this species population especially in the Indian and Pacific oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Sailfish are divided into stocks of the Western Atlantic, Eastern Atlantic, Eastern Pacific, Western Central Pacific and Indian Oceans.

Atlantic Ocean
There are two stocks of Sailfish in the Atlantic: one in the western Atlantic, and one in the eastern Atlantic. There is considerable uncertainty regarding the status of Atlantic Sailfish stocks, but most models present clear evidence of overfishing and that stocks are overfished, more in the east than in the west. The eastern stock is more productive than the western, probably providing greater maximum sustainable yield (MSY). The eastern stock is probably suffering stronger overfishing and has been reduced further below the level that would produce MSY than the western stock. Both eastern and western stocks suffered greatest declines prior to 1990. Since 1990, trends in relative abundance conflict between different indices, with some indices suggesting declines, other increases, and others not showing a trend. Examination of length frequencies do not show changes in the average length or length distribution (ICCAT 2009).

Using combined indices of relative abundance (Table 9, ICCAT 2009), both eastern and western Atlantic Sailfish stocks appear to be stable or increasing over the three generation length period (13 years). The combined indices were chosen over the biomass indices, as the population models which estimated biomass were not considered to be a good fit to the available data. Overall, there is data uncertainty, but the combined indices suggest no strong changes over the length of period examined. The greatest declines in Atlantic Sailfish occurred prior to the three generation lengths.

Eastern Pacific Ocean
There has been no effort to assess the status of Sailfish or Spearfish species in a comprehensive manner in the Pacific. There has been no stock assessment for the Eastern Tropical Pacific (ETP). Catches have been fairly stable over the past 10–25 years at around 2,000 mts, however catches are likely higher than reported given that they are grouped in billfishes. There has not been any real directed fishing for this species recently. It is a very important sportfish in the ETP. There are some indications of localized declines. Overall Sailfish abundance is 80% below the 1964 levels in Costa Rica, Guatemala and Panama (Erhart and Fitchett 2006). Trophy fish sizes are 35% smaller than unexploited sizes (Erhard and Fitchett 2006).

Western Central Pacific
Data for sailfish are not routinely recorded, however, it is inferred that no significant declines are occurring.

Indian Ocean
In the Indian Ocean, Sailfish landings are sometimes combined with other billfish species. The landing information on Marlins and Sailfish for the whole Pacific Ocean is not available, except for the FAO statistics which are not informative as the species are reported as a mixed group. There have been reports of decline in sailfish in India and Iran (IOTC 2009), but no information is available on effort. Catches in the Indian Ocean are generally thought to be increasing.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This is a commercial fish that is also caught as bycatch in the global long-line tuna fishery. It is also accidentally caught by commercial fishermen with surface drift nets by trolling, harpooning and set netting. It is most important as a sports fish. The flesh is dark red and not as good as that of marlin. Sport fishing could pose a potential threat locally, especially as this species is found primarily near shore and around islands.

The greatest catch rates in the world for sailfish occur in the Eastern Pacific ocean off Central America where this species supports multi-million dollar sport fisheries (catch and release) (Erhart and Fitchett 2006). In the national long-line fisheries in Costa Rica, many of the fishes are discarded as the fisheries are only allowed to bring in 15% of the catch as sailfish, so that catch are likely under reported. Costa Rica dominates the catch in the Eastern Pacific. Recent catch per unit effort (CPUE) data from the recreational fishery off of Central America has generated cause for concern (Kitchell et al. 2004).

In the Atlantic, this species is taken primarily by longline fisheries, but also by purse seines, and by some artisanal gears which are the only fisheries targeting marlins (Ghana, Cote d'Ivoire) and also by various sport fisheries located on both sides of the Atlantic. The increasing use of anchored fish aggregating devices (FADs) by various artisanal and sport fisheries is increasing the vulnerability of these stocks. Many assessment model results show evidence of overfishing, more so in the eastern than in the western Atlantic stocks (STECF 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This is a highly migratory species is listed in Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department 1994).

Size limitations, encouragement of catch-and-release sport fishing, and recommendations for using circle hooks instead of J-hooks are measures designed to increase survival in catch-and-release sport fishing (Serafy et al. 2009). In some areas long-lining is restricted to protect populations of billfishes for sports fishermen. The sports fisheries have mostly developed catch and release programmes rather than keeping the fish. In Costa Rica, Sailfish cannot be targeted in commercial fisheries and can only be landed as bycatch. Only 15% of catches are allowed to be sailfish, so some of the fish are discarded and the catch is likely under reported.

The catch of Sailfish by Japan, Korea, and Taiwan include the catch of Spearfish, though species-specific catch data are beginning to be collected in the Japanese longline fishery. It is probable that there may be other source of bias in landing information. It is necessary to review and check the catch of billfish country by country in detail (Uozumi 1999).

In the Atlantic, the International Commission fr the Conservation of Atlantic Tunas Standing Committee on Research and Statistics (ICCAT-SCRS) in 2009 recommended that catches for the eastern stock should be reduced from current levels. The Committee recommended that catches of the western stock of sailfish should not exceed current levels. Any reduction in catch in the West Atlantic is likely to help stock re-growth and reduce the likelihood that the stock is overfished. Artisanal fishermen harvest a large part of the sailfish catch of the western sailfish stock. The ICCAT-SCRS is concerned about the incomplete reporting of Sailfish catches, particularly for the most recent years, because it increases uncertainty in stock status determination. The ICCAT-SCRS recommends all countries landing or having dead discards of Sailfish, report these data to the ICCAT Secretariat (ICCAT 2009).

No ICCAT regulations for Sailfish are in effect, however, some countries have established domestic regulations to limit the catch of Sailfish. Among these regulations are, requirement of releasing all billfish from longline vessels, adoption of circle hooks, and catch and release strategies in sport fisheries (ICCAT 2009). Regulations for the U.S., Bahamas and Bermuda include no commercial sale. The Mexican government allows Sailfish to be taken only with sport fishing gear (de Guevara et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indo-Pacific sailfish

Exhibiting sail-raising behavior

The Indo-Pacific sailfish, Istiophorus platypterus, is a sailfish native to the Indian and Pacific Oceans. It is dark blue on top, brown-blue laterally, silvery white underbelly; upper jaw elongated in form of spear; first dorsal fin greatly enlarged in the form of a sail, with many black cones, its front squared off, highest at its midpoint; pelvic fins very narrow, reaching almost to the anus; body covered with embedded scales, blunt at end; lateral line curved above pectoral fin, then straight to base of tail. They have a large and sharp bill, that they use for hunting. They feed on tuna and mackerel, some of the fastest fish in the Ocean. They are able to prey on the faster fish in the sea because their top speed has been clocked at 109 km/h (68 mph), making them one of the fastest fish in the ocean. The Indo-pacific sailfish is related to the Marlin.

It is theorized by marine biologists that the 'sail' (dorsal fin array) of the sailfish may serve the purpose of a cooling and heating system for this fish; this due to a network of a large number blood vessels found in the sail and because of "sail-raising" behaviour exhibited by the sailfish at of near the surface waters after or before high-speed bursts.

Fisheries

Capture of Indo-Pacific sailfish in tonnes from 1950 to 2009

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!