Overview

Comprehensive Description

Description

  Common names: wrasse (English), señorita (Espanol)
 
Halichoeres chierchiae Di Caporiacco, 1947


Wounded wrasse


Moderately elongate, compressed; enlarged canine teeth at front of both jaws (1 pair above, 2 pairs below), a canine at rear of top jaws; dorsal fin IX, 11; anal rays III, 12; pectoral rays 13; lateral line unbroken, but abruptly bent down under rear of dorsal fin, its tubes branched, except those on tail base; lateral line with 26-27 pored scales.


IP:  with greenish-brown midlateral stripe intersecting with dark bars and blotches on upper half of body, lower portion of head and body pale yellow green; TP:  mainly bluish on upper half with green blotches, yellow on lower half; a black blotch above tip of pectoral fins, a similar-sized patch of bright red immediately behind this; fins reddish; juvenile color pattern is similar to that of  H. nicholsi, except it is darker, and the ocellus an the dorsal fin is smaller and less well defined.


Size: attains at least 20 cm.

Habitat: common on shallow rocky reefs with occasional sand-rubble patches.

Depth: 1-70 m.

Southern Baja and the Gulf of California to northern Peru, and the Revillagigedos and the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Commonly encountered in rocky reefs and sandy areas adjacent to reefs. Feeds on mollusks, crabs, brittle stars and sea urchins. Not utilized for human consumption.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and is found from southern Baja and the Gulf of California to northern Peru, and the Galapagos archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Central Pacific: Gulf of California to Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 70 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 20.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 175 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.5 cm TL (male/unsexed; (Ref. 9311))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Thie reef-associated species is commonly encountered in rocky reefs and sandy areas adjacent to reefs to depths of 70m. At Gulf of Chiriqui, this fish could be found in all types of substrata, except sand and rubble (Dominici-Arosemena and Wolff, 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 69 m (Ref. 9311), usually 2 - 23 m (Ref. 9311)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.35 - 19.5

Graphical representation

Depth range (m): 1.35 - 19.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 69m.
From 2 to 69 meters.

Habitat: reef-associated. Commonly encountered in rocky reefs and sandy areas adjacent to it. Feeds on molluscs, crabs, brittle stars and sea urchins. Not utilized for human consumption.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Commonly encountered in rocky reefs and sandy areas adjacent to reefs. Feeds on mollusks, crabs, brittle stars and sea urchins. Mobile-invertebrate feeder (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Halichoeres chierchiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Halichoeres chierchiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGCGCCTGAGCTGGGATGGTAGGCACGGCCTTAAGCCTGCTTATTCGGGCTGAATTAAGCCAACCCGGCGCTCTCCTTGGGGACGATCAGATCTATAACGTAATCGTTACAGCGCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGATTCGGAAACTGACTGATTCCCCTAATGATTGGAGCCCCTGATATGGCCTTCCCTCGAATGAATAACATAAGCTTTTGACTTCTCCCTCCTTCATTCCTTCTCCTCCTCGCCTCTTCTGGCGTAGAAGCCGGAGCTGGGACAGGCTGAACAGTCTACCCCCCTCTAGCGGGGAATCTTGCTCACGCCGGTGCATCTGTAGACTTAACAATCTTCTCCCTACACTTAGCTGGTATCTCGTCAATTTTAGGGGCTATCAACTTTATTACAACGATTATTAATATGAAACCTCCTGCCATCTCCCAGTACCAAACTCCCCTGTTTGTGTGGGCTGTATTAATTACAGCCGTATTGCTCCTGCTCTCTCTTCCCGTCCTCGCTGCCGGTATTACAATGCTTCTAACAGACCGAAATCTAAACACCACTTTCTTTGACCCTGCAGGAGGAGGTGACCCAATTCTATATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Robertson, R., Rivera, F., Edgar, G., Zapata, F. & Rocha, L.

Reviewer/s
Sadovy, Y. & Craig, M.

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and common throughout most of its range. There are no known major threats to this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout most of its range on the continental coast. However, it is considered uncommon in the Galapagos Islands.

According to Aburto-Oropeza and Balart (2001), H. chierchiae is a common species at Los Islotes, Gulf of California, with an occurrence frequency between 10-30%. In Cabo Pulmo, Mexico, this fish was considered scarce, with a relative abundance between 0.1-1%, and a relative frequency between 25-50% (Villarreal-Cavazos et al. 2000). In Bahía de Navidad, Jalisco, still in México, this fish was not captured within 12 (one each month) field trips throughout a year (Rojo-Vázquez et al. 2001). Surveys conducted at Gorgona Island coral reefs, Colombia (Zapata and Morales, 1997; Rubio, 1986), also could not find this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. According to Dominici-Arosemena et al. (2005), this is a important aquarium fish in Gulf of Papagayo, Costa Rica, however, such localized collecting is unlikely to significantly affect the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!