Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: jobfish (English), pargo (Espanol)
 
Aphareus furca (Lacepède, 1801)

Small-toothed jobfish



Elongate, fusiform body; head pointed; flattened between eyes; mouth not protractile, large, lower jaw projecting ; teeth minute, no canines; no teeth on roof of mouth; tail deeply forked with pointed tips; dorsal X, 10-11; anal III, 8;  last rays of dorsal and anal fins filamentous; pectoral long, 15-16 rays; lateral line scales 65-75; dorsal and anal scaleless.


Purplish-brown above, blue-grey below, a silver sheen over body;  edges of preopercle and opercle black.

        Size: 70 cm.

Habitat: inshore rocky and coral reefs.

Depth: 5-70 m.

        Indo-Pacific; resident at Cocos in the eastern Pacific; also at Malpelo Is.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit inshore coral and rocky reefs and in clear waters of lagoons (Ref. 9821). Pelagic and benthopelagic (Ref. 58302). Occur singly or in small groups. Feed mainly on fishes, but also eats crustaceans. Individuals with brilliant yellow on head may be nuptial males (Ref. 9821). Often curious and approachable (Ref. 9710). Marketed fresh.
  • Anderson, W.D. Jr. and G.R. Allen 2001 Lutjanidae. Jobfishes. p. 2840-2918. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 5. Bony fishes part 3 (Menidae to Pomacentridae). FAO, Rome. (Ref. 9821)   http://www.fishbase.org/references/FBRefSummary.php?id=9821&speccode=81 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian Islands, north to southern Japan, south to Australia. Reported from Cocos Island in the eastern Pacific (Ref. 9821).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan, south to northern Western Australia, New Caledonia and Tonga; Eastern Pacific: Cocos Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 70 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 70.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 5484)); max. published weight: 906 g (Ref. 4887)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits inshore coral and rock reefs. Occurs solitarily or in small groups. Feeds mainly on fishes, but also eats crustaceans. Individuals with brilliant yellow on head may be nuptial males (Ref. 9821). Marketed fresh.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lower jaw protruding; maxilla extending to below middle of the eye; interorbital space flattened. Dorsal and anal fins without scales. Edges of preopercle and opercle outlined with black. A silvery sheen on head and lower sides. Pectoral fins long reaching to about level of anus. Back and upper sides purplish -brown; the sides blue-gray; the fins whitish to yellow-brown. May show bright yellow on the nape during courtship. Small juveniles have a yellow caudal fin (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Aphareus furca
Catalog Number: USNM 49691
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): United States Fish Commission (USFC)
Locality: Hawaiian Islands, Hawaii, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 122 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 1.5 - 50000
  Temperature range (°C): 23.541 - 28.905
  Nitrate (umol/L): 0.053 - 9.845
  Salinity (PPS): 33.754 - 35.274
  Oxygen (ml/l): 3.591 - 4.953
  Phosphate (umol/l): 0.076 - 0.831
  Silicate (umol/l): 0.912 - 10.063

Graphical representation

Depth range (m): 1.5 - 50000

Temperature range (°C): 23.541 - 28.905

Nitrate (umol/L): 0.053 - 9.845

Salinity (PPS): 33.754 - 35.274

Oxygen (ml/l): 3.591 - 4.953

Phosphate (umol/l): 0.076 - 0.831

Silicate (umol/l): 0.912 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 122m.
From 1 to 122 meters.

Habitat: reef-associated. Blue smalltooth job.  (Lacepede, 1801) Attains 70 cm. Steel blue colour. Small ones occasionally with bright yellow patches on snout or head. Found in mid-waters of clear lagoons and seaward reefs in 1 to 120 m. Solitary or in small groups, feeds on small fishes and crustaceans. Often curious and approachable. East Africa to Panama, north to Ryuk, south to L.Howe & Austral Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Mid Water, Near Bottom, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Water column

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabit inshore coral and rocky reefs and in clear waters of lagoons. Occur singly or in small groups. Depth range 1-122 m (Ref. 58472). Feed mainly on fishes, but also eats crustaceans. Individuals with brilliant yellow on head may be nuptial males (Ref. 9821). Often curious and approachable (Ref. 9710). Attain 70 cm FL (Ref. 58472).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: Pelagic crustacea, zooplankton, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aphareus furca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Aphareus furca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGTACGGCCCTTAGCCTACTCATTCGGGCAGAGCTGAGCCAACCAGGCGCGCTTCTTGGAGACGACCAAATTTATAACGTAATCGTTACAGCCCACGCATTTGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGCGGCTTTGGAAATTGACTGATCCCCCTAATGATTGGGGCTCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTTTGACTATTGCCCCCATCTTTTCTTCTTCTCCTTGCCTCTTCTGGCGTAGAAGCCGGGGCTGGGACTGGGTGAACAGTTTATCCCCCACTAGCGGGCAATCTAGCCCATGCAGGAGCATCCGTTGACCTCACCATCTTTTCTCTTCACTTAGCAGGTGTTTCTTCAATCCTGGGGGCAATTAACTTCATTACAACCATTATTAATATGAAACCTCCCGCTATTTCCCAATATCAGACACCCCTGTTTGTATGAGCTGTTCTAATTACCGCTGTGCTACTTCTTCTTTCACTTCCAGTTCTCGCTGCCGGGATTACAATACTTCTTACAGACCGAAATTTAAATACTACTTTCTTTGACCCGGCGGGAGGAGGAGATCCAATTCTTTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!