Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Triggerfish are a warm water species, which only occasionally swim in the North Sea. This unusual fish is named after the appearance of the front spine on its back, which looks like a pistol trigger. This spine can be erected and held in place by the adjacent spine, which is then held in place by the third spine. In that way, triggerfish use their dorsal fin when in danger to clamp themselves in a crevice between rocks on the sea floor. It's almost impossible for the attacker to get the fish out of the crevice.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits bays, harbors, lagoons, and seaward reefs (Ref. 9710). May drift with young at surface among Sargassum (Ref. 9710). Usually solitary or in small groups (Ref. 9710). Feeds on benthic invertebrates like mollusks and crustaceans (Ref. 4727). Oviparous (Ref. 205). Consumed mostly fresh, smoked, and dried salted. The flesh is of excellent quality. Because it is resistant to capture, it proliferates and competes for food with other species (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The trigger fish Balistes capriscus is commonly known as the grey trigger fish. It is brownish green to grey in colour and reaches a maximum length of 40cm. The mouth is small and 'beak like' with fleshy lips. Body form is laterally flattened to allow manoeuvring in shallow rocky areas or wrecks that they inhabit. The first dorsal fin can be locked upright and then unlocked by depressing the second spine, the 'trigger'.Common in the Mediterranean, where spawning occurs in water temperatures above 12°C. As they are poor swimmers, it is likely they arrive in the Eastern Atlantic to the North coast of Angola via the Gulf Stream. They may increase in numbers in Britain and Ireland because of warmer seas due to global warming.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina; observed in Trundy Reef, Cape Elizabeth, ME at 43o35.405N, 70o11.902W (photo ID verified by LVG 7 Aug 2008)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Mediterranean to Moçamedes, Angola. Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Mediterranean to Moçamedes, Angola. Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 26 - 29; Analspines: 0; Analsoft rays: 23 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

60.0 cm TL (male/unsexed; (Ref. 7348)); max. published weight: 6,150 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 60 cm TL (male/unsexed); max. weight: 1,300.0 g.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Tall, with a small mouth and plate like scales (Ref. 35388). Three faint irregular broad dark bars on body; a narrow pale transverse band on chin; small light blue spots on upper half of body and median fins, and irregular short lines ventrally (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits bays, harbors, lagoons, and seaward reefs.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 100 m (Ref. 7348), usually 0 - 55 m (Ref. 55172)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1826 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1267 samples.

Environmental ranges
  Depth range (m): 0 - 2012
  Temperature range (°C): 4.038 - 27.724
  Nitrate (umol/L): 0.217 - 33.242
  Salinity (PPS): 32.507 - 37.958
  Oxygen (ml/l): 2.516 - 6.548
  Phosphate (umol/l): 0.038 - 1.936
  Silicate (umol/l): 0.756 - 27.828

Graphical representation

Depth range (m): 0 - 2012

Temperature range (°C): 4.038 - 27.724

Nitrate (umol/L): 0.217 - 33.242

Salinity (PPS): 32.507 - 37.958

Oxygen (ml/l): 2.516 - 6.548

Phosphate (umol/l): 0.038 - 1.936

Silicate (umol/l): 0.756 - 27.828
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Mainly rocky bottoms and floating wreckage at depths between 10-100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; marine; depth range 0-100 m. Inhabits bays, harbors, lagoons, and seaward reefs. May drift with young at surface among Sargassum. Usually solitary or in small groups.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits bays, harbors, lagoons, and seaward reefs (Ref. 9710). May drift with young at surface among Sargassum (Ref. 9710). Feeds on benthic invertebrates like mollusks and crustaceans (Ref. 4727).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on benthic invertebrates like mollusks and crustaceans.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on benthic invertebrates like mollusks and crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning in summer; eggs laid on bottom in a cavity made by female and guarded by the male. Juveniles without elongated caudal rays.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Balistes capriscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Balistes capriscus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATCTTTGGTGCTTGGGCTGGGATAGTAGGCACAGCTTTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCCGGCGCCCTTTTAGGCGATGATCAAATTTATAATGTTATCGTCACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTCATTCCCTTAATAATTGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAACATGAGCTTCTGGCTTCTCCCCCCCTCTTTACTCCTACTCCTCGCCTCCTCAAGCGTAGAAGCGGGAGCCGGAACTGGTTGAACAGTGTATCCCCCTCTCGCGGGGAACCTCGCCCATGCAGGAGCCTCTGTTGATCTAACCATCTTTTCATTACATTTAGCGGGTATTTCGTCAATTCTGGGGGCAATTAWCTTTATTACAACAATTATTAACATAAAACCCCCTGCTATTTCTCAATATCAAACGCCCTTGTTTGTCTGAGCAGTCCTAATTACGGCTGTTCTTCTCCTTTTATCGCTCCCCGTCCTAGCCGCCGGCATTACAATGCTTCTCACTGATCGAAACTTAAATACCACATTCTTTGACCCTGCAGGAGGCGGCGACCCCATCCTTTACCAACACCTCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey triggerfish

The grey triggerfish (Balistes capriscus) is a ray-finned fish in the triggerfish family. The species is native to shallow parts of the western Atlantic from Nova Scotia to Argentina and also the eastern Atlantic, the Mediterranean Sea and off Angola on the west coast of Africa.

In its appearance and habits, the grey triggerfish is a typical member of the genus Balistes except for its drab, uniformly grey colouration. It is a relatively small fish, usually less than 2.3 kg (5 lb) in weight. It is fished recreationally and despite its tough skin, is an excellent food-fish.

Description[edit]

The grey triggerfish is a medium-sized fish that can grow to 60 cm (24 in), but a more common length is 44 cm (17 in). The small beak-like mouth at the tip of the snout has fleshy lips. The eyes are set far back near the top of the head. The body is laterally compressed and deep-bodied with a tough, leathery skin. The front dorsal fin has three spines, the first being very strong and much longer than the other two. The second dorsal fin has 26 to 29 soft rays and is much the same size and shape as the anal fin directly below it which has no spines and 23 to 26 soft rays. The pectoral fins are small and rounded. The outer rays of the caudal fin are elongated in larger individuals. The scales on the head and front half of the body are large while those on the hind half are smaller and smooth.[2][3]

This fish is predominantly pale grey, greenish-grey or yellowish-brown. The body has three indistinct broad dark bars and there is a pale streak on the chin. The upper part of the orbit of the eye is blue and there are some small blue spots and lines on the dorsal fins and upper parts of the body, and sometimes white dots and irregular lines on the lower parts of the body. Both the second dorsal and the anal fin present a somewhat marbled appearance. The body colour fades a little as the animal gets older: juveniles are more colourful.[2][3]

Distribution and habitat[edit]

The grey triggerfish is principally a fish of shallow waters in the western Atlantic Ocean. Its native range extends from Nova Scotia to the Caribbean Sea, the Gulf of Mexico and Bermuda, and southwards to Argentina. It is typically found over hard bottoms on reefs and rocky areas, in lagoons and in bays, at depths down to about 55 m (180 ft). It is also found on the other side of the Atlantic, around the British Isles, in the Mediterranean Sea and off the coast of Angola.[3] It may have crossed the Atlantic as a result of the movement of water in the Gulf Stream. It does not breed in the waters around Britain but does do so in the Mediterranean.[4]

Behaviour[edit]

Grey triggerfish

Locomotion in the grey triggerfish is by means of undulations of the dorsal fins. If threatened, the fish can work its way into a protective crevice and wedge itself in place by erecting its front dorsal spine. It is difficult to dislodge from this position. The second spine is connected to the first and when it is depressed, it triggers the unlocking of the first spine.[3]

The grey triggerfish is a demersal species and feeds on bottom-dwelling invertebrates such as shrimps, crabs, molluscs, sea urchins, sand dollars, starfish and sea cucumbers. It has strong teeth specialised for making holes in hard-shelled prey. An interesting feeding behaviour has been observed, in which the fish positions itself vertically above a sandy seabed and puffs a stream of water out of its mouth. This disturbs the substrate and may reveal something edible. Further puffs expose more, and the prey item is gripped with the fish's sharp teeth and removed from the seabed. If it is a sand dollar, the fish drops it and picks it up again several times until the prey lands upside down. The fish then adopts its vertical stance once more and attacks the middle with closed jaws, crushing the soft central area. It then scoops out and devours the flesh.[3]

Males develop a charcoal grey colouration and are highly territorial during the breeding season, which commences in summer when the water temperature reaches about 21 °C (70 °F). The males prepare up to a dozen nests in hollows blown out of sandy seabed[5] and then patrol the area, driving unwanted fish away. The females roam around inspecting the nest sites. When a female is ready to spawn, both male and female enter a nest and tightly circle round each other while she lays large numbers of minute eggs and he fertilises them. The female stays in the nest, guarding the eggs and blowing and fanning them. The male defends his territory, which may contain other nests with females guarding their eggs. In this way, the male exhibits harem behaviour.[6] Wrasses and red snappers sometimes feed on the eggs which, if they survive that long, hatch after about fifty hours. The fish larvae migrate up towards the surface of the water where they often become part of the community depending on floating sargassum weed. There they feed on algae, barnacles, hydroids and polychaete worms. In the autumn, when they reach about 15 cm (6 in), the juvenile fish leave the sargassum and sink down to the sea bed.[3]

Recreational fishing[edit]

The grey triggerfish is fished recreationally around Florida and elsewhere. It is known as a notorious bait stealer and is found over hard bottom in 20 to 40 m (66 to 131 ft) depths off the Atlantic Coast of Florida, often in association with black sea bass and red snapper. Because of its bony mouth it needs a small sharp hook which is usually baited with squid or cut bait.[7] The flesh is of high quality but the consumption of this fish has been linked to isolated cases of ciguatera poisoning.[3]

References[edit]

  1. ^ a b Bailly, Nicolas (2013). "Balistes capriscus Gmelin, 1789". World Register of Marine Species. Retrieved 2014-02-20. 
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2006). "Balistes capriscus" in FishBase. June 2006 version.
  3. ^ a b c d e f g Bester, Cathleen. "Gray triggerfish". Florida Museum of Natural History. Retrieved 2014-02-20. 
  4. ^ Reeds, Kate (2008). "Trigger fish: Balistes capriscus". Marine Life Information Network. Retrieved 2014-02-20. 
  5. ^ Florida Museum of Natural History site
  6. ^ Simmons, Carrie M.; Szedlmayer, Stephen T. (2012). "Territoriality, Reproductive Behavior, and Parental Care in Gray Triggerfish, Balistes capriscus, from the Northern Gulf of Mexico". Bulletin of Marine Science 88 (2): 197–209. doi:10.5343/bms.2011.1012. 
  7. ^ "Gray triggerfish: Balistes capriscus". Fishing: Recreational regulations. Florida Fish and Wildlife Conservation Commission. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!