Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Triggerfish are a warm water species, which only occasionally swim in the North Sea. This unusual fish is named after the appearance of the front spine on its back, which looks like a pistol trigger. This spine can be erected and held in place by the adjacent spine, which is then held in place by the third spine. In that way, triggerfish use their dorsal fin when in danger to clamp themselves in a crevice between rocks on the sea floor. It's almost impossible for the attacker to get the fish out of the crevice.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits bays, harbors, lagoons, and seaward reefs (Ref. 9710). May drift with young at surface among Sargassum (Ref. 9710). Usually solitary or in small groups (Ref. 9710). Feeds on benthic invertebrates like mollusks and crustaceans (Ref. 4727). Oviparous (Ref. 205). Consumed mostly fresh, smoked, and dried salted. The flesh is of excellent quality. Because it is resistant to capture, it proliferates and competes for food with other species (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The trigger fish Balistes capriscus is commonly known as the grey trigger fish. It is brownish green to grey in colour and reaches a maximum length of 40cm. The mouth is small and 'beak like' with fleshy lips. Body form is laterally flattened to allow manoeuvring in shallow rocky areas or wrecks that they inhabit. The first dorsal fin can be locked upright and then unlocked by depressing the second spine, the 'trigger'.Common in the Mediterranean, where spawning occurs in water temperatures above 12°C. As they are poor swimmers, it is likely they arrive in the Eastern Atlantic to the North coast of Angola via the Gulf Stream. They may increase in numbers in Britain and Ireland because of warmer seas due to global warming.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Black Sea, Greek Exclusive Economic Zone, Gulf of Mexico, IJsselmeer, Irish Exclusive economic Zone, Madeira, Mediterranean Sea, North West Atlantic, Pacific Ocean, Swedish Exclusive Economic Zone, UK, Wenduine Bank, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Mediterranean to Moçamedes, Angola. Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina; observed in Trundy Reef, Cape Elizabeth, ME at 43o35.405N, 70o11.902W (photo ID verified by LVG 7 Aug 2008)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Mediterranean to Moçamedes, Angola. Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Argentina.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 26 - 29; Analspines: 0; Analsoft rays: 23 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

60.0 cm TL (male/unsexed; (Ref. 7348)); max. published weight: 6,150 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 60 cm TL (male/unsexed); max. weight: 1,300.0 g.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Tall, with a small mouth and plate like scales (Ref. 35388). Three faint irregular broad dark bars on body; a narrow pale transverse band on chin; small light blue spots on upper half of body and median fins, and irregular short lines ventrally (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 100 m (Ref. 7348), usually 0 - 55 m (Ref. 55172)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits bays, harbors, lagoons, and seaward reefs.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1826 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1267 samples.

Environmental ranges
  Depth range (m): 0 - 2012
  Temperature range (°C): 4.038 - 27.724
  Nitrate (umol/L): 0.217 - 33.242
  Salinity (PPS): 32.507 - 37.958
  Oxygen (ml/l): 2.516 - 6.548
  Phosphate (umol/l): 0.038 - 1.936
  Silicate (umol/l): 0.756 - 27.828

Graphical representation

Depth range (m): 0 - 2012

Temperature range (°C): 4.038 - 27.724

Nitrate (umol/L): 0.217 - 33.242

Salinity (PPS): 32.507 - 37.958

Oxygen (ml/l): 2.516 - 6.548

Phosphate (umol/l): 0.038 - 1.936

Silicate (umol/l): 0.756 - 27.828
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Mainly rocky bottoms and floating wreckage at depths between 10-100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; marine; depth range 0-100 m. Inhabits bays, harbors, lagoons, and seaward reefs. May drift with young at surface among Sargassum. Usually solitary or in small groups.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits bays, harbors, lagoons, and seaward reefs (Ref. 9710). May drift with young at surface among Sargassum (Ref. 9710). Feeds on benthic invertebrates like mollusks and crustaceans (Ref. 4727).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on benthic invertebrates like mollusks and crustaceans.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawning in summer; eggs laid on bottom in a cavity made by female and guarded by the male. Juveniles without elongated caudal rays.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Harmelin-Vivien, M.L. and J.C. Qu?, 1990; Lieske, E. and R. Myers, 1994; Tortonese, E., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balistes capriscus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATCTTTGGTGCTTGGGCTGGGATAGTAGGCACAGCTTTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCCGGCGCCCTTTTAGGCGATGATCAAATTTATAATGTTATCGTCACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTCATTCCCTTAATAATTGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAACATGAGCTTCTGGCTTCTCCCCCCCTCTTTACTCCTACTCCTCGCCTCCTCAAGCGTAGAAGCGGGAGCCGGAACTGGTTGAACAGTGTATCCCCCTCTCGCGGGGAACCTCGCCCATGCAGGAGCCTCTGTTGATCTAACCATCTTTTCATTACATTTAGCGGGTATTTCGTCAATTCTGGGGGCAATTAWCTTTATTACAACAATTATTAACATAAAACCCCCTGCTATTTCTCAATATCAAACGCCCTTGTTTGTCTGAGCAGTCCTAATTACGGCTGTTCTTCTCCTTTTATCGCTCCCCGTCCTAGCCGCCGGCATTACAATGCTTCTCACTGATCGAAACTTAAATACCACATTCTTTGACCCTGCAGGAGGCGGCGACCCCATCCTTTACCAACACCTCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balistes capriscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey triggerfish

The grey triggerfish (Balistes capriscus) is a triggerfish of the western Atlantic, found from Nova Scotia to Argentina.

It is also reported from the Mediterranean sea and off Angola on the west coast of Africa. It has also been reported in the Gulf of Mexico in depths of 5-10 feet.

In its appearance and habits, the Gray Triggerfish is a typical member of the Balistes family except for its drab, uniformly gray coloration. It is a relatively small fish, usually less than 2.3 kilograms (5 pounds) in weight.

The Gray Triggerfish is a notorious bait stealer, found over hard bottom in 20 to 40 meter (60 to 120 foot) depths off the Atlantic Coast of Florida often in association with Black Sea Bass and Red Snapper.

Despite its tough skin, with a texture resembling concrete, it is an excellent food-fish, with firm, tasty white flesh, as served in the form of skinless, boneless fillets.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!