Overview

Comprehensive Description

Biology

Occurs in lagoons, channels, and semi-protected seaward reefs rich in corals. Relatively common near arborescent Acropora or layered Porites rus corals. Feeds on plankton such as crab larvae. Marketed fresh (Ref. 3418).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to Tuamoto Islands, north to the Ryukyu Islands, south to New Caledonia and the Austral Islands; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinctive combination consisting of a silvery-violet sheen, orange tips on the fins, and a dark orange-red opercular bar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 4 - 25m.
From 4 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 25 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 89 samples.

Environmental ranges
  Depth range (m): 1 - 46
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.019 - 2.517
  Salinity (PPS): 33.507 - 36.148
  Oxygen (ml/l): 4.338 - 4.806
  Phosphate (umol/l): 0.071 - 0.495
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 1 - 46

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.019 - 2.517

Salinity (PPS): 33.507 - 36.148

Oxygen (ml/l): 4.338 - 4.806

Phosphate (umol/l): 0.071 - 0.495

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in inshore waters. Nocturnal species (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis violacea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTCTAAGCCTTCTCATTCGAGCTGAGCTTAGCCAACCCGGAGCACTTCTGGGCGACGACCAGATTTATAACGTAATCGTTACGGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGAGGTTTCGGAAACTGACTTATTCCCCTAATGATCGGCGCCCCCGACATGGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTGGCCTCATCAGGGGTAGAAGCCGGAGCCGGAACAGGATGAACTGTATACCCGCCTCTAGCAGGAAACCTAGCCCACGCAGGGGCTTCCGTTGATCTCACCATCTTCTCACTTCACCTAGCAGGTATCTCCTCAATTCTAGGGGCTATCAACTTTATTACAACAATTATTAATATGAAACCTCCAGCCATCTCTCAATACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTTTCCCTCCCTGTCCTTGCTGCTGGCATCACTATGCTTCTAACTGACCGAAACCTAAACACTACCTTCTTCGACCCAGCTGGAGGTGGAGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis violacea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!