Overview

Comprehensive Description

Biology

Found on continental slope and rise between temperatures of 12°C to 4°C (Ref. 3590). Usually solitary; probably forms occasional aggregates. Feeds on mysids and benthopelagic copepods. Synchronously hermaphroditic (Ref. 6688).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Atlantic: northeastern Atlantic to off Sierra Leone; one record from the Mediterranean; one record from the Northwestern Atlantic (Grand Banks)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Current records suggest that this species is endemic to the Mediterranean Sea, where it is widespread. It is present in the Ligurian Sea (Tortonese 1971, Barletta and Torchio 1986), Balearic Islands (D'onghia et al. 2004), Ionian Sea (D'onghia et al. 2004), Catalan Sea (west Mediterranean; Sardà et al. 1994, Carrasson and Cartes 2002, Carrasson and Matallanas 2001), south Adriatic (Ungaro et al. 2002), Levantine basin, and east Mediterranean Sea basin (Klausewit 1989, Goren and Galil 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: northeast Atlantic to off Sierra Leone; one record from the Mediterranean. One record from the northwest Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic from British Isles to Sierra Leone, Azores, Mediterranean Sea; one record from northwestern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 205 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.5 cm SL (male/unsexed; (Ref. 3590)); 20.4 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Bathypterois dubius
Catalog Number: USNM 42088
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): N. Talisman
Year Collected: 1883
Locality: Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Bathypterois dubius
Catalog Number: USNM 42087
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): N. Talisman & Museum National d'Histoire Naturelle, Paris
Year Collected: 1883
Locality: Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on continental slope and rise between temperatures of 12°C to 4°C. Usually solitary; probably forms occasional aggregates.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a bathydemersal species, it is found on continental slope and rise between temperatures of 4-12°C (Merrett 1990). It is usually solitary, but it probably forms occasional aggregates.

Within the northwestern sector of the Mediterranean Sea, this species appeared starting below 700 m, its relative abundance and biomass increased progressively going deeper. It reaches his maximum between 1,500-2,000m (Morales-Nin et al. 1996).

It feeds on mysids and benthopelagic copepods. The most important food items are benthopelagic planktonic calanoid copepods. In the Catalan Sea, juveniles are found between 1,800-2,250 m, and are recorded to feed secondary on benthic tanaidaceans, whereas for the adults, mysids are secondary. At other depths, calanoid copepods are consumed almost exclusively. Adults ingest larger amounts and sizes of prey than juveniles (Carrasson and Matallanas 2001). It is synchronously hermaphroditic (Sulak 1984).

In the Ionian Sea, this species is found between 800-3,300 m (D'Onghia et al. 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 260 - 2800 m (Ref. 3397), usually 2100 - 2300 m (Ref. 32939)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 137 specimens in 1 taxon.
Water temperature and chemistry ranges based on 78 samples.

Environmental ranges
  Depth range (m): 429.5 - 1900
  Temperature range (°C): 3.267 - 9.983
  Nitrate (umol/L): 16.909 - 27.498
  Salinity (PPS): 34.900 - 35.900
  Oxygen (ml/l): 3.190 - 6.416
  Phosphate (umol/l): 1.010 - 1.925
  Silicate (umol/l): 9.705 - 23.953

Graphical representation

Depth range (m): 429.5 - 1900

Temperature range (°C): 3.267 - 9.983

Nitrate (umol/L): 16.909 - 27.498

Salinity (PPS): 34.900 - 35.900

Oxygen (ml/l): 3.190 - 6.416

Phosphate (umol/l): 1.010 - 1.925

Silicate (umol/l): 9.705 - 23.953
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 750 - 1950m.
From 750 to 1950 meters.

Habitat: bathydemersal. Found on continental slope and rise between temperatures of 12°C to 4°C (Ref. 3590). Probably forms occasional aggregates. Feeds on mysids and benthopelagic copepods. Synchronously hermaphroditic (Ref. 6688).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on continental slope and rise between temperatures of 12°C to 4°C (Ref. 3590). Probably forms occasional aggregates. Feeds on mysids and benthopelagic copepods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on mysids and benthopelagic copepods
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathypterois mediterraneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTCTCGGGAGAC---GACCAAATTTATAACGTAATCGTTACCGCACACGCTTTTGTAATAATTTTTTTTATAGTAATACCAATCATGATTGGGGGTTTCGGAAACTGACTGATCCCCCTTATG---ATCGGGGCCCCCGATATGGCATTCCCACGAATAAATAACATAAGTTTCTGACTGCTACCCCCTTCCTTCCTTCTTCTCCTCTCTTCTTCAGGCGTAGAGGCCGGTGCAGGGACTGGGTGAACTGTGTACCCCCCCCTCGCCAGCAACCTGGCCCACGCCGGGGCATCTGTAGACTTA---ACCATCTTCTCTCTGCATTTGGCAGGCATTTCTTCAATCCTAGGGGCTATCAACTTTATTACAACTATTATTAACATAAAACCCCCCGCCATTTCCCAGTATCAGACCCCCCTATTTGTCTGGTCAGTTCTAATTACAGCCGTTTTACTACTTCTCTCTCTCCCTGTTCTCGCGGCA---GGAATTACCATGCTCCTAACCGACCGAAACTTAAATACAACCTTTTTTGACCCTGCGGGCGGAGGTGACCCTATCCTGTACCAACACTTGTTTTGGTTCTTCGGTCACCCCGAAGTCTATATCCTTATCCTTCCTGGGTTTGGAATAATTTCCCACATCGTAGCTTACTACTCAGGCAAGAAG---GAGCCTTTCGGTTACATGGGCATGGTTTGGGCCATAATGGCAATTGGCCTTCTCGGCTTTATTGTTTGAGCACACCACATGTTTAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathypterois mediterraneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bathypterois dubius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathypterois dubius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Papakonstantinou, C., Massuti, E. & Palmeri, A. and Keskin, Ç.

Reviewer/s
Livingstone, S. & Pollard, D. and Carpenter, K.

Contributor/s

Justification
This is a widespread and common species with no known major threats. Therefore this species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widespread and very abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is not commercially exploited. No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Trawling is banned below 1,000 m in European waters in the Mediterranean Sea. This species may be present in Marine Protected Areas that occur within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bathypterois dubius

The Mediterranean spiderfish, Bathypterois dubius, a lizardfish of the family Ipnopidae, is found in the Eastern Atlantic, as well as the Mediterranean and northwest Atlantic.

Like other species in its family, the Mediterranean spiderfish is hermaphroditic. It is solitary in nature and feeds on mysids and copepods. It reaches a length of 20.5 centimetres (8.1 in) SL.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!