Overview

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs (Ref. 1602). Mainly diurnal. Non-burrowing. Monogamous (Ref. 52884). A protandrous hermaphrodite (Ref. 32166). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Heteractis magnifica (usually), Heteractis crispa, Macrodactyla doreensis, and Stichodactyla gigantea (Ref. 5911). In Bali they occur together with the closely related Indian Ocean species A. akallopison and have even been found sharing the same anemone (Ref. 48636). Has been reared in captivity (Ref. 35413, 35418, 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Gulf of Thailand and Cocos-Keeling in the eastern Indian Ocean to Samoa and Tonga (Ref. 53797), north to the Ryukyu Islands, south to the Great Barrier Reef, and New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Amphiprion perideraion are distributed throughout tropical regions in the western Pacific and Indian Oceans. Their range includes the Gulf of Thailand, Cocos Islands and Christmas Island in the eastern Indian Ocean. In the Indo-Australian Archipelago in the Pacific, they are found from Samoa and Tongo, north to the Ryukyu Islands, Fiji, and Micronesia, extending southward to the Great Barrier Reef and New Caledonia.

Biogeographic Regions: oriental (Native ); indian ocean (Native ); pacific ocean (Native )

  • Randall, J., J. Williams, D. Smith, M. Kulbicki, G. Tham, P. Labrosse, M. Kronen, E. Clua, B. Mann. 2003. Checklist of the shore and epipelagic fishes of Tonga. Tonga: Atoll Res. Bull. Nos.
  • Fautin, D., G. Allen. 1992. Field guide to anemonefishes and their host sea anemones. Francis Street, Perth: Western Australian Museum.
  • Allen, G. 1975. The anemone fishes. Their classification and biology. Second edition. Neptune City, New Jersey: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 10; Dorsal soft rays (total): 16 - 17; Analspines: 2; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Amphiprion perideraion are typically pink to pinkish orange in color. Fins are pale to transparent. They have a very distinct white dorsal stripe extending from the head to the caudal tail. A second, vertical, stripe is observed between the head and the rest of the body. Amphiprion perideraion have 9 or 10 well-developed dorsal spines and 2 anal spines. They have 16 or 17 dorsal soft rays and 12 or 13 anal soft rays. Likewise, they have highly developed pharyngeal teeth and a premaxilla with an ascending process, resulting in very effective suction feeding.

They reach a maximum length of 10 cm (Lieske and Myers, 1994; Fautin and Allen, 1992).

Similar species include A. nigripes, A. leucokranos, A. sandaracinos and A. sandaracinos. Amphiprion nigripes can be distinguished by a black belly, pelvic area and anal fins and a more reddish color. Amphiprion leucokranos have much wider and broader stripes which don't extend the full lenth of the body. The remaining two species lack the white head bar present in A. perideraion.

Females are slightly longer than males at 5.5 cm (compared to 4.6 cm) at maturity.

Range length: 10 (high) cm.

Average length: 4.6-5.5 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color orange. Fins transparent. One white stripe following the dorsal contour from snout to caudal peduncle. One white vertical stripe between head and trunk.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; brackish; marine; depth range 1 - 38 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These fish are found in lagoons and seaward reefs (Fautin and Allen, 1992; Myers, 1991). They are non-migratory fish living in brackish marine water with depths ranging up to 38 meters and temperatures around 25°C. These fish live in symbiotic relationships with various sea anenomes including Heteractis crispa, Hetaractis magnifica, Macrodactyla doreensis and Stichodactyla gigantea. Amphiprion perideraion often occurs in the same environment with the closely related Amphiprion akallopison, often in the same anemone (Kuiter and Tonozuka, 2001).

Range depth: 1 to 38 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

  • Myers, R. 1991. Micronesian reef fishes. Second Ed.. Barrigada, Guam: Coral Graphics.
  • Kuiter, R., Tonozuka. 2001. Pictorial guide to Indonesian reef fishes. Part 2. Fusiliers - Dragonets, Caesionidae - Callionymidae. Australia: Zoonetics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 1 - 41
  Temperature range (°C): 25.161 - 28.359
  Nitrate (umol/L): 0.203 - 0.834
  Salinity (PPS): 33.797 - 35.374
  Oxygen (ml/l): 4.436 - 4.754
  Phosphate (umol/l): 0.079 - 0.198
  Silicate (umol/l): 1.370 - 2.220

Graphical representation

Depth range (m): 1 - 41

Temperature range (°C): 25.161 - 28.359

Nitrate (umol/L): 0.203 - 0.834

Salinity (PPS): 33.797 - 35.374

Oxygen (ml/l): 4.436 - 4.754

Phosphate (umol/l): 0.079 - 0.198

Silicate (umol/l): 1.370 - 2.220
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 38m.
From 1 to 38 meters.

Habitat: reef-associated. Inhabits lagoon and seaward reefs (Ref. 1602). A territorial species, found exclusively in the large colorful anemone @Heteractis magnifica@. Occurs at 25°C. Mainly diurnal. Non-burrowing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Lives together with sea anemones inhabiting coral reefs. Commensal with Radianthus ritteri; usually one adult pair and several juveniles at each anemone. Feeds predominantly on benthic algae and zooplankton (Ref. 237).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

A. perideraion use suction feeding. The maxilla pushes the premaxilla forward, which causes an area of low pressure inside the mouth, resulting in suction.

Amphiprion perideraion exploit a wide range of phytoplankton (blue-green algae and diatoms), zooplankton and zoobenthos. This makes them omnivorous generalists. Amphiprion perideraion collect food from surrounding areas near their host anemones. They have also been known to consume food leftover from their host.

Studies have shown that Amphiprion frenatus experience a rapid growth during their juvenile stage. This rate is affected by contact with sunlight, likely due to a higher abundance of plankton. It's likely that there's selective pressure for larger fish, as smaller ones do not have the chance to mate.

Animal Foods: aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Plant Foods: algae; phytoplankton

Primary Diet: omnivore ; planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Amphiprion perideraion live with their host anemone in a symbiotic relationship. These fish are coated with a mucus which helps to protect them from the sting of the anemone. The toxic stings of anemones protect anemone fish from predators and anemones obtain food particles in the water column as a result of anemone feeding.

Species Used as Host:

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Amphiprion perideraion are preyed on by large, predatory fish, notably groupers (Serranidae). The primary defense used by these fish is their ability to survive within sea anemones. The toxic stings of anemones protects resident fish from predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Skin Fungi (Saprolegnia sp.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coral fish Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication among Amphiprion perideraion is not well-understood. They perceive their environment through visual, chemical, and tactile cues and are likely to use these modes of perception in communication.

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). One pair spawns several times per year. Annual fecundity is estimated to be 2,000 to 4,000 eggs. Size at sex change = 5.4 cm TL (Ref. 55367). Also Ref. 240, 7471.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Once the eggs of A. perideraion hatch, they take on a planktonic form where they are carried from the natal host anemone and float in the water column.

At the end of their larval period, A. perideraion enter a juvenile stage where they metamorphose. Metamorphosis involves the development of the white bands as well as a general migration to different depths of water and host anemones. Evidence suggests that juveniles progressively forage in a smaller area as they become adults.

Members of the genus Amphiprion occupy a single anemone for their entire life, rarely swimming more than several meters from their host. These groups consist of one female, but many include several males. The female is the largest member of the colony and the dominant male is the next largest. The others, while male, are functionally sterile unless one of the two dominant fishes die.

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Allen, G. 1991. Damselfishes of the World. Melle, Germany: Mergus Publishers.
  • Balon, E. 1990. Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev., 1: 1-48.
  • Coughlin, D., J. Strickler, B. Sanderson. 1992. Swimming and search behaviour in clownfish, Amphiprion perideraion, larvae. Animal Behavior, 44: 427-440.
  • Arvedlund, M., M. McCormick, T. Ainsworth. 2000. Effects of Photoperiod on Growth of Larvae and Juveniles of the Anemonefish Amphiprion melanopus. Naga, The ICLARM Quarterly, 23/2: 18-23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Currently, there is very little available data regarding the lifespan of Amphiprion. Some data suggests that the lifespan is around ten years. Amphiprion percula have a record of 18 years in captivity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Amphiprion perideraion are monogamous fish where only two of the representatives of a group are actually involved in the mating. The female and dominant male are strictly monogamous. When the female dies, the largest male undergoes a sex change and becomes the mating female. After this, the second largest male actively becomes involved in mating.

In spawning, male A. ocellaris chase females, passing over the nest. With each pass, the female lays a line of eggs which adhere to the rock surface. The male then fertilizes the eggs and protects them from predators.

Mating System: monogamous

Amphiprion perideraion spawn several times between April and August, but sometimes as early as February, depending on the conditions. In this species, the largest fish is always the female and the second largest fish is always the male. Fish are male first until the female dies (protandrous). During a year, the pair may produce between 2000 and 4000 eggs. Both males and females reach maturity between 1.75 and 1.83 years of age.

While little research has actually been done on the reproductive mechanisms of A. perideraion, a similar species Ampiprion ocellaris showed several interesting reproductive mechanisms. Females control males through agression and chase away other females. Dominant males build a nest on a bare rock face near an anemone. Courtship behavior in A. ocellaris includes the extension of spines, biting, and chasing.

Breeding interval: Amphiprion perideraion will breed several times a year with no obvious peak season.

Breeding season: They breed between April and August.

Range number of offspring: 2000 to 4000.

Range age at sexual or reproductive maturity (female): 1.75 to 1.83 years.

Range age at sexual or reproductive maturity (male): 1.75 to 1.83 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); oviparous

Male Amphiprion perideraion protect the developing eggs while they are attached to the substrate just outside of the host anemone, for about 6 to 8 days. When the eggs hatch, the larvae leave the host anemone.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Male)

  • Allen, G. 1991. Damselfishes of the World. Melle, Germany: Mergus Publishers.
  • Allen, G. 1975. The anemone fishes. Their classification and biology. Second edition. Neptune City, New Jersey: T.F.H. Publications, Inc..
  • Thresher, R. 1984. Reproduction in reef fishes. Neptune City, New Jersey: T.F.H. Publications, Inc. Ltd..
  • Balon, E. 1990. Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev., 1: 1-48.
  • Boyer, M., P. Bearzi, F. Ricciardi. 2004. "Pink anemone fish" (On-line). Accessed October 18, 2005 at http://www.edge-of-reef.com/pomacentridi/clownfishen.htm.
  • Boyer, S. 2005. "Florida Museum of Natural History Ichthyology Department" (On-line). Accessed October 18, 2005 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/PinkAnemonefish/PinkAnemonefish.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion perideraion

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGGTTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTTCTTCTGCTTGCCTCCTCAGGGGTTGAAGCGGGGGCCGGAACAGGCTGAACTGTATACCCACCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCAGTAGACCTAACTATCTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATTACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTCCTCCTCTCTCTCCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion perideraion

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is not listed as endangered or threatened and there are no immediately forseeable plans to place it on the IUCN Red List.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Amphiprion perideraion on humans. They are considered harmless.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Amphiprion perideraion is a common aquarium fish and is thus of economic value to humans. They are quite appealing to divers, and their presence may encourage ecotourism.

Positive Impacts: pet trade ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pink skunk clownfish

The pink skunk clownfish or pink anemonefish, Amphiprion perideraion, is a skunk clownfish found in the west Pacific Ocean. It is known to be one of the smaller clownfish. They can be found off the Cocos and Christmas Islands in the eastern Indian Ocean, and the Indo-Australian Archipelago.[1]

Images

References

  1. ^ Entry at Animal-world
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!