Overview

Brief Summary

Like all species in the family Diodontidae, Long-spined Porcupinefish (Diodon holocanthus) can inflate themselves by swallowing water (or air). As in other species in the genus Diodon, this swelling causes the erection of the long movable spines covering the body. The Long-spined Porcupinefish is a robust fish with rounded dorsal and anal fins. Spines on the forehead of the Long-spined Porcupinefish are slightly shorter to much longer than are those immediately behind the pectoral fin base. Long-spined Porcupinefish have a broad dark bar through the eyes and, usually, four dark saddles on the back. The rest of the body is brownish yellow, paler below, with dark brown spots of moderate size (no spots on the fins beyond their bases). These spots are larger than the diameter of the spines. No spines are wholly on the caudal peduncle. Pelagic juveniles are around 6 to 9 cm. Maximum adult standard length (i.e., excluding tail) is around 30 cm, with a maximum total length of around 45 to 50 cm. In North American waters, the similar Spotted Porcupinefish (Diodon hystrix) is larger (to 91 cm), lacks the dark bars on the back and through the eyes, is covered with small dark spots that are around the same diameter as the spines, has the longest spines posterior to the pectoral fins, and has one or more spines wholly on the caudal peduncle.

The Long-spined Porcupinefish has a circumtropical distribution in the Atlantic, Pacific, and Indian Oceans (except that it seems to occur only peripherally on the Pacific Plate). It is found in the Atlantic from Florida and the Bahamas to Brazil and in the Pacific from the Gulf of California to Peru (see Leis 2006 for more details on geographic distribution).

Long-spined Porcupinefish are nocturnal and usually solitary. They feed on hard-shelled invertebrates. Larger individuals are found in a variety of benthic habitats from shallow reefs to open, soft bottoms to at least 100 m. In some areas, Long-spined Porcupinefish are harvested and dried in their inflated state for sale to tourists.

See Leis (2006) for a comprehensive key to identify the seven or eight genera and 18 or 19 species in the family Diodontidae that are recognized as valid by the author.

(Boschung et al. 1983; Eschmeyer and Herald 1983; Robins and Ray 1986; Leis 2003, 2006)
  • Boschung, H.T., Jr., Williams, J.D., Gotshall, D.W., Caldwell, D.K., and M.C. Caldwell. 1983. The Audubon Society Field Guide to North American Fishes, Whales, and Dolphins. Alfred A. Knopf, New York.
  • Robins, C.R. and G.C. Ray. 1986. A Field Guide to Atlantic Coast Fishes of North America. Houghton Mifflin, Boston.
  • Eschmeyer, W.N. and E.S. Herald. 1983. A Field Guide to Pacific Coast Fishes of North America. Houghton Mifflin, Boston.
  • Leis, J.M. 1978. Systematics and zoogeography of the porcupine-fishes (Diodon, Diodontidae, Tetraodontiformes) with comments on egg and larval development. U.S. Fish. Bull76(3): 535-567.
  • Leis, J.M. 1986. Family Diodontidae. Pp. 903-907 in: Smith’s Sea Fishes (M.M. Smith and P.C. Heemstra, eds.). Macmillan South Africa, Johannesburg,
  • Leis, J.M. 2002. Diodontidae. Pp. 2007-2013 in: FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Volume 1. Introduction, molluscs, crustaceans, hagfishes, sharks, baroid fishes, and chimaeras (K.E. Carpenter, ed.). FAO, Rome.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Common names: porcupinefish (English), balloonfish (English), pez erizo (Espanol)
 
Diodon holocanthus Linnaeus, 1758


Freckled porcupinefish,     Long-spine balloonfish


Body a robust oval, inflatable; head wide and blunt; a pair of small barbels on chin; eyes large; nasal organ a tentacle with 2 openings; teeth fused into a strong, parrot-like beak that lacks a front groove, large, opens widely at front; gill opening a vertical slit before pectoral base; pectorals large; fins without spines; no pelvic fins; dorsal 13-15; anal rays 13-14; pectoral rays 22-25; body and head covered with numerous long (> eye), erectible, 2-rooted, slender, round spines; 12-16 spines in an approximate row from top of snout to dorsal fin; anterior middle spines on top of head longer than longest spines posterior to pectoral fins; no spines on tail base.


Light olive to pale brown, shading to white ventrally;  small black spots on upper two-thirds of head and body; a brown bar from above to below eye; a broad brown bar across occipital region and another across middle of back; a large oval brown blotch above each pectoral fin and another around dorsal-fin base; fins plain.


Size: attains 50 cm.

Inhabits reefs and open sand-rubble bottoms.

Depth: 1-100 m.

Circumtropical distribution; southern California to the Gulf of California to northern Peru and all the offshore islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Inhabit shallow reefs to open, soft bottoms. Also in areas with rocky substrata. Sometimes form groups (Ref. 9710, 48637). Occur on open muddy substrates as well as on rich soft-bottom and coral reefs. Juveniles often with floating Sargassum rafts. Young and sub-adults may form small groups (Ref. 48637). Benthopelagic (Ref. 58302). Juveniles pelagic to about 6-9 cm. Solitary. Feed on mollusks, sea urchins, hermit crabs, and crabs at night (Ref. 9680). Relatively poor swimmers (Ref. 9710). Used in Chinese medicine (Ref. 12166). Captured at the surface using a hand net (Ref. 26165).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Diodon liturosus is distributed circumtropically throughout the world (Hobson 1974; FLMNH). In the U.S. it is found along the Pacific coast, the Florida Keys and Hawaii (Hobson 1974; Waikiki Aquarium 1999). It is widespread in the Caribbean and eastern Asia (Hobson 1974; FLMNH).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circumtropical in distribution; Western Atlantic: Near Georges Bank to Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Mauritius, North West Atlantic, Red Sea, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 100 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumtropical in distribution. Western Atlantic: Canada (Ref. 5951), Florida, USA and the Bahamas to Brazil (Ref. 7251). Eastern Atlantic: 30°N to 23°S (Ref. 6951); also South Africa (Ref. 4423). Western Indian Ocean: southern Red Sea to Madagascar, Reunion and Mauritius (Ref. 53568). Pacific Ocean: southern Japan south to Lord Howe Island and east to the Hawaiian and Easter islands (Ref. 37816). Also from southern California, USA to Colombia (Ref. 11482) and the Galapagos Islands (Ref. 5227).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Diodon liturosus, also known as the balloonfish or spiny puffer, can reach lengths from about 30.5 to 61 cm. It has dark patches along its sides and back, but perhaps its most telling feature is the long spines that protrude from all over its body, excluding the fins and face. The spines are actually modified scales, which lay flat against its body most of the time (Waikiki Aquarium 1999). In some relatives of the balloonfish, a toxic chemical, tetrodotoxin, is found in the skin and spines. However, only trace amounts of tetrodotoxin have been found in balloonfish, mainly concentrated in the ovaries (Chen and Chou 1998). In appearance, D. liturosus resembles its closest cousin, D. hystrix, also known as the porcupinefish. However, an easy way to tell these two apart (without getting too close) is by checking for spots on the fins: D. hystrix has them, while D. liturosus does not (FLMNH).

Balloonfish expand by swallowing mouthfuls of air or water when attacked by a predator. The balloonfish swallows air, when attacked by avian predators, or water, when attacked by piscine predators (Brainerd 1994). After ingestion through the mouth, the air or water reaches the highly elastic stomach, which has been described as a "large dilatable sac with robust esophageal and pyloric sphincters" (Rosen, 1912). The stomach, which has lost its digestive function, plays a key role in the inflation process (Brainerd 1994). In Diodontidae, the stomach is a simple sac, whereas in Tetraodontidae the stomach is divided into two parts by a pyloric sphincter. As the stomach expands, it pushes the peritoneal lining into the ample peritoneal space. The peritoneal cavity expands towards the head to the mandible and towards the tail to enclose the unpaired fins (Brainerd 1994).

The skeletal structure of D. liturosus also facilitates inflation. Because the balloonfish lacks pleural ribs and a pelvic girdle, expansion is not as strictly inhibited as in most fish. The vertebral column is also highly flexible. It bends in an arc towards the dorsal side of the fish, allowing D. liturosus to attain its characteristic spherical shape upon inflation (Brainerd 1994).

In addition to the elastic stomach, generous peritoneal space and skeletal structure, balloonfish skin is also specialized for inflation (Brainerd 1994). The skin of D. liturosus is highly elastic because of microfolds in the epidermis and collagen fibers of the dermis. These allow D. liturosus to extend through 40% of its initial length before it begins to stiffen (Brainerd 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 15; Analspines: 0; Analsoft rays: 13 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 50.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow reefs to open, soft bottoms to at least 100 m . Also in areas with rocky substrata. Sometimes forms groups (Ref. 9710). Juveniles pelagic to about 6-9 cm. Solitary. Feeds on molluscs, sea urchins, hermit crabs and crabs at night (Ref. 9680). A relatively poor swimmer (Ref. 9710).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic juveniles with spots, particularly prominent on belly; adults with dark blotches across back and spots between the blotches; fins without spots (Ref. 4423). 14 to 16 spines in an approximate row between snout and origin of dorsal fin; with a large brown bar above and below each eye; a broad transverse brown bar on occipital region of head (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Adult balloonfish are found in relatively shallow areas of the ocean. They prefer grassy flats, coral reefs, and mangrove areas (Randall 1967; FLMNH; Nagelkerken et. al 2000). The larvae however, are found in the pelagic (open water) zone (FLMNH). They bob around in their shells for about 4 days before hatching (FLMNH).

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits shallow reefs to open, soft bottoms. Also in areas with rocky substrata. Sometimes forms groups.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 0 - 450
  Temperature range (°C): 12.277 - 29.282
  Nitrate (umol/L): 0.122 - 14.999
  Salinity (PPS): 32.279 - 37.151
  Oxygen (ml/l): 3.677 - 5.432
  Phosphate (umol/l): 0.055 - 0.981
  Silicate (umol/l): 1.123 - 11.692

Graphical representation

Depth range (m): 0 - 450

Temperature range (°C): 12.277 - 29.282

Nitrate (umol/L): 0.122 - 14.999

Salinity (PPS): 32.279 - 37.151

Oxygen (ml/l): 3.677 - 5.432

Phosphate (umol/l): 0.055 - 0.981

Silicate (umol/l): 1.123 - 11.692
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 100m.
From 2 to 100 meters.

Habitat: reef-associated. Inhabits shallow reefs to open, soft bottoms. Also in areas with rocky substrata. Sometimes forms groups (Ref. 9710). Juveniles pelagic to about 6-9 cm. Solitary. Feeds on molluscs, sea urchins, hermit crabs, and crabs at night (Ref. 9680). A relatively poor swimmer (Ref. 9710). Used in Chinese medicine (Ref. 12166).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 200 m (Ref. 5951), usually 2 - 35 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The teeth of both the upper and lower jaws of D. liturosus are fused, forming a solid, heavy beak (Hobson 1974; Waikiki Aquarium 1999). This beak makes cracking the shells of snails, sea urchins and hermit crabs a breeze. With the help of its relatively large eyes, D. liturosus feeds at night on these delicacies of the coastal zone (Waikiki Aquarium 1999). As for catching its prey, D. liturosus certainly does not rely on speed. It is actually a slow-swimming predator (Waikiki Aquarium 1999). What D. liturosus can do is maneuver into tricky positions using its pectoral, pelvic and anal fins. This is especially helpful in complex habitat such as coral reefs. D. liturosus uses its tail primarily for steering and for occasional bursts of speed (Waikiki Aquarium 1999).

Diodon liturosus is a nocturnal predator and remains hidden during the day (Hobson 1974; Waikiki Aquarium 1999; FLMNH). Individuals have been observed resting near ledges and shallow caves of the rocky sea floor in the Gulf of California and ledges or holes in the Florida Keys in the daytime (Hobson 1974). In coral reefs around Hawaii and the West Indies, D. liturosus' main food source is pagurid crabs (hermit crabs) and prosobranch gastropods, which include familiar marine organisms such as abalones, limpets, top shells, periwinkles, boat shells, conchs, moon snails, and whelks (Hobson 1974; FLMNH;Randall 1967; Waikiki Aquarium 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits lagoon and seaward reefs (Ref. 37816, 58534) to open shallow, soft bottoms. Occurs on open muddy substrates as well as on rich soft-bottom and coral reefs. Also in areas with rocky substrata. Young and sub-adults may form small groups (Ref. 48637). Juveniles pelagic to about 6-9 cm. Solitary. Feeds on mollusks, sea urchins, hermit crabs, shellfish and crabs at night (Ref. 9680, 54301). Mobile-invertebrate feeder (Ref. 57615, 57616). A relatively poor swimmer (Ref. 9710). A relatively poor swimmer (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Lymphocystis Disease. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Diodon liturosus reproduces through sexual processes, just like most other fish. Sexual reproduction maintains genetic diversity within the species, which is important for preventing disease and adapting to changes in the environment over time. During spawning season, a male pushes a female to the surface and they immediately spawn (FLMNH). The round eggs float in the water. Until they are 10 days old, D. liturosus larvae retain a thin shell covering, which is then lost (FLMNH). At this time, D. liturosus begins to develop spines. The larvae metamorphosize after about 3 weeks (FLMNH). After this metamorphosis, fins and fin rays are present, the teeth are formed, and adult olive and brown coloring develops (FLMNH). Dark spots appear on the belly, which may help camouflage the juveniles in floating sargassum from underwater predators such as the mahi mahi (FLMNH). The juvenile loses this underside spotting when it reaches the adult stage. At this point in development, spine elongation and body growth occur. The larval stage of D. liturosus is yellow with red spots and well-developed functional mouth, eyes and gas bladder (FLMNH ).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diodon holocanthus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC4928-08|NC_009866|Diodon holocanthus| ACGCGATGATTCTTCTCAACCAACCACAAAGACATTGGCACTCTTTATTTAGTATTTGGTGCCTGGGCCGGAATGGTTGGGACGGCGCTT---AGCCTCCTAATCCGAGCCGAACTTAGTCAACCTGGGAGCCTCCTTGGAGAC---GACCAAATTTACAATGTCATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTTGGAAACTGACTGGTGCCACTAATA---ATCGGCGCCCCAGACATGGCCTTCCCCCGAATAAATAATATGAGCTTTTGACTTCTCCCTCCCTCCTTCCTTCTCCTCCTTGCTTCCTCAGGCGTAGAAGCCGGTGCCGGCACAGGATGAACAGTATACCCACCACTCGCGGGCAACCTGGCCCACGCAGGAGCCTCCGTAGACCTG---ACTATTTTCTCTCTTCACCTTGCAGGAGTTTCTTCTATTCTAGGAGCAATTAATTTTATTACAACAATTATCAACATAAAACCCCCTGCAATCTCCCAATACCAAACCCCCCTTTTCGTCTGAGCCGTTCTAATCACCGCCGTCCTCCTGCTTCTCTCCCTTCCAGTCCTTGCTGCA---GGAATTACAATGCTCCTCACCGACCGAAACCTCAACACCACTTTCTTTGACCCAGCAGGGGGCGGTGATCCTATCCTTTATCAACACCTCTTCTGATTCTTTGGTCATCCTGAAGTCTATATCCTTATCCTCCCAGGATTCGGTATAATCTCACATATTGTAGCCTACTATTCCGGTAAAAAA---GAGCCCTTTGGCTACATGGGTATAGTCTGGGCAATAATAGCAATCGGCCTTCTGGGCTTCATTGTCTGAGCCCACCACATGTTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diodon holocanthus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Species: 41
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Relatives of D. liturosus are popular in Asian sushi restaurants. However, D. liturosus is not normally consumed. Dried, inflated bodies of D. liturosus are however, a relatively common novelty for tourists on vacation in tropical areas (FLMNH).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: commercial; price category: Taken as bycatch.; price reliability: not marketed/unknown
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-spine porcupinefish

Spiny fish.jpg

The long-spine porcupinefish is also known as the spiny balloonfish.

Contents

Range

The Long-spine porcupinefish is circumtropical in distribution, being found in the tropical zones of major seas and oceans:

Description

Pale in colour with large black blotches and smaller black spots, these spots becoming fewer in number with age. Has many long, two-rooted depressible spines. Adults may reach 50 cm (20 in) in length.[2]

Diet

Feeds on mollusks (molluscs), sea urchins, hermit crabs, snails, and crabs during its active phase at night.[1]

Habitat

Found over the muddy sea bottom, or in lagoons or seaward and reefs around the world.

Spawning

Spawns at the surface at dawn or at dusk in pairs or in groups of males with a single female; the juveniles remain pelagic until they are at least 7 cm (3 in) long.[2] Young and sub-adult fish sometimes occur in groups.

Uses

It is used in Chinese medicine, and is captured at the surface with a hand net. It is poisonous if not prepared correctly.

References

  1. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2007). "diodon holocanthus" in FishBase. 6 2007 version.
  2. ^ a b Lieske, E. and Myers, R.F. (2004) Coral reef guide; Red Sea London, HarperCollins ISBN 0-00-715986-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!