Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An offshore species found mainly around coral reefs. Generally solitary or occur in small schools of six or less. Preys on small schooling fishes such as Decapterus, Caesio, Nasio, Cirrhilabrus, Pterocaesio and squids. Marketed canned and frozen (Ref. 9684, 48637). Adults may be ciguatoxic (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This Indo-Pacific species is found from the Red Sea and East Africa to French Polynesia, north to Japan, south to Australia. Its distribution is disjunct as this species is found primarily around reefs. There are several records from Taiwan (Taiwan Fisheries Research Institue FRIP 21529) that was caught as bycatch in tuna long-line.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Comores and Mascarenes east to French Polynesia, north to southern Japan and Ogasawara Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to French Polynesia, north to Japan, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Dogtooth tuna (Gymnosarda unicolor) are found in the Indo West Pacific, from Australia (the Great Barrier Reef) to East Africa and the Red Sea, and in the waters off of the coast of Japan and the Philippines, New Guinea, Marquesas, Tahiti, Tuamotus, Pitcairn, and Oeno Islands.

Biogeographic Regions: oceanic islands (Native ); indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 15; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 12 - 13; Vertebrae: 38
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Dogtooth tuna are members of the mackerel family. Distinguishing features include a streamlined body with a large head and a mouth that contains twenty sharp dog-like teeth per jaw. They have two dorsal fins; the first is spiny and large, and the second, right behind it is soft-rayed. The ventral fin is similar in size and shaped like the second dorsal. Nine spiny finlets stretch down the upper and lower tail section toward its crescent shaped tailfin. This species exhibits counter shading and has no scales. The dorsal surface is blue green, the sides are silver, and the belly is white. They swim constantly with their mouth open to force water through the gills because of a high oxygen requirement and great muscular activity. An unusual vessel system in the liver and tail provides counter-current temperature exchange, raising the body temperature 6°C to 12°C higher than the water temperature. They can reach speeds of up to 80 kph (50 mph). Dogtooth tuna's average weight is 15 to 20 kg (33 to 44 lbs). The spear fishing record is 55 kg and the all-tackle record is 131kg (288 lbs).

Range mass: 131 (high) kg.

Average mass: 15-20 kg.

Other Physical Features: endothermic ; ectothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2200 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

248 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 131.0 kg (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

An offshore species found mainly around coral reefs at water temperatures ranging between 20 and 28°C. Generally solitary or occur in small schools of six or less individuals. Prey on small schooling fishes such as scads (@Decapterus@), @Caesio@, @Nasio@, @Cirrhilabrus@, @Pterocaesio@ and squids. Marketed canned and frozen (Ref. 9684).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mouth fairly large, upper jaw reaching to middle of eye. Laminae of olfactory rosette 48 to 56. Interpelvic process large and single. Lateral line strongly undulating. Body naked posterior to corselet. Swim bladder large, spleen visible in ventral view on the right side of the body. The back and upper sides brilliant blue-black, lower sides and belly silvery; no lines, spots or other markings on the body.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef-associated and oceanodromous, found offshore mainly around coral reefs, and may occur to depths of at least 300 m (Braud and Grand Perrin 1984). It is generally solitary or occurs in small schools of six or less. It preys on small schooling fishes such as Decapterus, Caesio, Nasio, Cirrhilabrus, Pterocaesio and adults may be ciguatoxic (Randall 1980).

Size at first maturity is 65 cm fork length (FL) (Lewis et al. 1983). Maximum Size is 247 cm FL. The all-tackle angling record is of a 104.32 kg fish caught off LeMorne, Mauritius in 1993 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 10 - 100 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dogtooth tuna are typically pelagic, but are known to come inshore and are found around coral reefs and atolls at depths from 15m (50ft) to 45m (150ft). They prefer water temperatures between 21°C (70°F) and 26°C (80°F). They are migratory; their movements are linked to water temperatures and the fish they feed upon.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 30 samples.

Environmental ranges
  Depth range (m): 2.44 - 95
  Temperature range (°C): 24.485 - 28.954
  Nitrate (umol/L): 0.099 - 5.255
  Salinity (PPS): 34.131 - 34.761
  Oxygen (ml/l): 3.591 - 4.544
  Phosphate (umol/l): 0.113 - 0.567
  Silicate (umol/l): 1.579 - 10.063

Graphical representation

Depth range (m): 2.44 - 95

Temperature range (°C): 24.485 - 28.954

Nitrate (umol/L): 0.099 - 5.255

Salinity (PPS): 34.131 - 34.761

Oxygen (ml/l): 3.591 - 4.544

Phosphate (umol/l): 0.113 - 0.567

Silicate (umol/l): 1.579 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Dogtooth tuna feed upon shoaling fishes like herring (Clupea), sprats (Sprattus), mackerel (Scomber), whiting (Merlucciidae), cuttlefish (Sepia) and sometimes squid (Loligo).

Animal Foods: fish

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawning takes place around December, January, and February. Dogtooth Tuna are non-guarders and are classified as open water substratum egg scatterers. The eggs are small and float near the surface, hatching within two days. Larvae are .635cm (0.25 inch) long and grow very quickly.

Breeding season: Spawning takes place from December to February.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnosarda unicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTATCTAGTATTTGGTGCATGAGCTGGTATAGTTGGCACAGCCCTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTCACGGCGCATGCCTTCGTGATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGATTTGGAAACTGACTAATTCCCCTGATGATCGGGGCCCCGGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTTCCCCCCTCTTTCCTCCTGCTCTTAGCCTCTTCTGGGGTTGAAGCCGGTGCCGGAACTGGCTGAACAGTCTACCCACCTCTCGCCGGTAACCTAGCCCACGCTGGTGCATCTGTTGACCTAACCATTTTCTCTCTGCACTTAGCAGGTGTCTCCTCAATCCTTGGGGCCATTAACTTCATTACAACAATTATCAATATGAAACCCGCTGCTATTTCGCAGTATCAAACGCCCCTATTTGTTTGAGCTGTCCTAATTACAGCTGTCCTTCTCCTACTATCACTGCCAGTCCTTGCCGCTGGCATTACAATGCTTCTAACAGACCGAAACCTAAATACAACCTTCTTCGATCCTGCCGGAGGAGGAGATGCAATCCTTTACCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnosarda unicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Di Natale, A., Fox, W., Juan Jorda, M. & Nelson, R.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is widespread in the Indo-West Pacific. There is no population information available, but it is caught in artisanal and recreational fisheries throughout its range. There may be localized depletions given that it is a solitary species, but it is unlikely that there are currently widespread population declines. It is listed as Least Concern. More research is need on this species biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dogtooth tuna are susceptible to overfishing, and commercial net fishing is their biggest threat. Coupled with worldwide concern over dolphin free tuna, there is hope that this species can be protected with proper management. As yet, they have not made the ICUN red list and are not considered a threatened species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are no fisheries directed specifically at this species but it is regularly caught in small numbers mostly in artisanal fisheries with hand-lines, pole, and trolling during certain seasons in many parts of its range (Collette and Nauen 1983).

FAO worldwide reported landings fluctuate, but in general show a gradual increase in reported catch from 94 tonnes in 1971 to a high of 808 tonnes in 2003 (FAO 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This is a minor commercial species that is caught mainly by pole-and-line, and is also caught in sport fisheries There are no fisheries directed specifically at this species but it is regularly caught in small numbers mostly in artisanal fisheries with hand-lines, pole, and trolling during certain seasons in many parts of its range (Collette and Nauen 1983). Initial high catches are usually not maintained, perhaps because it is a solitary species and does not school.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures. This species may occur in some protected areas within its range, such as the Great Barrier Reef. More research is need on this species biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Ciguatera Fish Poisoning in humans is caused by the consumption of subtropical and tropical finfish. A naturally occurring toxin found in an algae (dinoflagellate) species common in the lower latitudes is the suspected cause. The occurrence of toxic fish is sporadic, and not all fish of a given species or locality will be toxic. Ciguatera poisoning is self-limiting: symptoms usually subside after a few days, are dismissed as seasickness or a hangover, and are therefore under reported.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Dogtooth tuna are a popular game fish. Many charter-fishing boats operate out of Australia and other parts of the south pacific providing a very lucrative business for their owners. They are also marketed commercially either canned or frozen.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dogtooth tuna

The dogtooth tuna is a large fast-swimming fish in the family Scombridae. It is placed in its own genus, Gymnosarda. It has the large teeth and straight edged first dorsal fin characteristic of the smaller bonitos (genus Sarda) and although it far exceeds them in size, reaching weights of over 150 kilograms, is considered more closely related to them than to the true tunas. The fish is known in Samoa and some other Pacific nations as tagi. In Mauritius it is referred to as the thon blanc, or white tuna. Its range extends from the Marshall Islands to the western Indian Ocean and as far north as southern Japan and South Korea, where the long-standing world record of 288 lbs was caught.

Dogtooth tuna frequent reef environments, with smaller fish being more commonly found near shallow reef areas and larger ones haunting deep reef drop off areas, seamounts and steep underwater walls. The dogtooth tuna is one of the apex non-pelagic predators in its environment, sharing that position with Giant Trevally, Napoleon Wrasse, and large groupers, as well as reef, bull and tiger sharks. An aggressive predator, the dogtooth tuna is an opportunistic feeder that is capable of taking a wide variety of prey items. In most areas the mainstay of its diet probably consists of pelagic schooling fish found near reef habitat, including fusiliers, carangids such as rainbow runners and mackerel scad, and scombrids.

The dogtooth tuna is appreciated in most of its range as a fine food fish and also as a game fish sought by both rod and reel anglers and spearfishermen. Dogtooth tuna used to be mostly taken as an incidental catch by anglers trolling for other gamefish - with natural baits for black marlin, for instance, or with lures for wahoo and Spanish (narrowbarred) mackerel. In the last 10 to 15 years there has been more dedicated effort directed at this species because of its rarity and sporting qualities. Dogtooth tuna are now a highly coveted prize by many European and Asian sports anglers. Large specimens are seldom found where there is significant fishing pressure and can be one of the most difficult gamefish to capture. Their habit of making high-speed downward runs when hooked, even on heavy tackle, often sees the line being cut as it contacts deep bottom structure. Sharks frequently mutilate both hooked and speared fish during the later stages of the fight, adding to the difficulty in landing them. The majority of dogtooth tuna captures have tended to be made by trolling with dead and live baits or with lures, particularly deep-swimming plugs. These techniques are still often used, with one niche specialty being the use of live bait such as rainbow runners to tease dogtooth tuna within range of light tackle and fly-casting anglers. High speed jigging with a variety of metal lures has increased tremendously in popularity in the last several years as advancements in tackle technology have resulted in lightweight rods and reels that are capable of handling heavy spectra-type braided lines. Some of the more popular destinations for anglers seeking this species include Okinawa and other islands of southern Japan, Rodrigues and other Indian Ocean islands such as the Maldives, Andaman & Nicobar Islands, Bali and elsewhere in Nusa Tenggara in Indonesia, the Great Barrier Reef and its outlying atolls, and many Western Pacific islands such as Vanuatu, Fiji, Tonga and Samoa.

Here is a picture of a smaller one [1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!