Table of Contents
Overview
Comprehensive Description
Description
Alosa alosa is a herring-like, planktivorous fish with silvery white sides and a deep blue colouration on its back. It is most commonly recorded at a size between 30 -50 cm but has been reported to reach 70 cm. Like other shads its upper jaw is distinctly notched in the mid line and the gill cover has distinct radiating ridges.The allis shad is distinguished from the other European shad, the twaite shad (Alosa fallax), by having between 80-130 gill rakers on the first gill arch while Alosa fallax has between 40-60. The allis shad is 'anadromous' in that it spends its life in the ocean but enters rivers in April and May to spawn before returning to the sea. Juveniles remain in the rivers for up to 24 months.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Biology
Amphihaline species, spending most of its life in sea (Ref. 51442); at sea, pelagic, in deep water down to 300 meters; juveniles resides close to the shore and estuaries (Ref. 59043). Schooling and strongly migratory species, penetrating far up rivers, spawning in main river or entering large and warm tributaries; spawning sites usually situated near a confluence (Ref. 188, 59043). Males migrate upriver at 3-9 years; females first reproduce 1-3 years later than males. Adult individuals approach coasts at end of February and enter rivers when 22-24°C is reached, usually in May. Spawning starts at when 15°C is reached; spawns in large, very noisy schools at night near the surface; eggs sink to the bottom. Spent fish migrate back to the sea, and most die after reproduction, having mated once. Most juveniles migrate to river mouth during first summer to remain at sea until mature. Individual fish apparently return to their natal spawning site. (Ref. 59043). Migrating adults do not feed (Ref. 30578); in freshwater, juveniles prey on insect larvae; at sea, the species feeds on a wide range of planktonic crustaceans; larger adults feed on small schooling fishes (Ref. 188, 51442, 59043). Marketed fresh and frozen; eaten sautéed, broiled, fried and baked (Ref. 9988). Less common than Alosa fallax but both have suffered from pollution and weirs or other obstructions (Ref. 188).
-
Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Distribution
Range Description
Baltic, North and western Mediterranean Seas, Atlantic coast of Great Britain, Ireland, France, Spain, Portugal and Morocco from where adults ascend rivers, migrating far upstream to spawn. Earlier ascended Rhine for about 850 km up to Basel (Switzerland). Now, nearly extirpated east of Rhine, most abundant in Loire and Garonne drainages (France). Landlocked populations in some man-made lakes in Morocco and Portugal.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Distribution
Belgian Exclusive Economic Zone, European waters (ERMS scope), Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeeschelde
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Poll, M. (1945). Contribution à la connaissance de la faune ichtyologique du Bas-Escaut. Bull. Mus. royal d'Hist. Nat. Belg./Med. Kon. Natuurhist. Mus. Belg. 21(11): 1-32
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1641
-
ILVO epifauna en demersale visdata: epifauna en demersale vismonitoring op het Belgisch deel van de Noordzee sinds 1979
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132964
-
Van Damme, P.A.; Hostens, K.; Ollevier, F.P. (1994). Fish species of the lower Zeeschelde (Belgium): a comparison with historical checklists. Belg. J. Zool. 124(2): 93-103
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132986
-
Hillewaert, H. 2010. Pers. com.
http://www.fishbase.org/aphia.php?p=sourcedetails&id=141989
-
Cattrijsse, A.; Vincx, M. (2001). Biodiversity of the benthos and the avifauna of the Belgian coastal waters: summary of data collected between 1970 and 1998. Sustainable Management of the North Sea. Federal Office for Scientific, Technical and Cultural Affairs: Brussel, Belgium. 48 pp.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=61
-
van der Land, J.; Costello, M.J.; Zavodnik, D.; Santos, R.S.; Porteiro, F.M.; Bailly, N.; Eschmeyer, W.N.; Froese, R. (2001). Pisces, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 357-374
http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1411
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Kedra, M. (2010). A Checklist of marine species occurring in Polish marine waters, compiled in the framework of the PESI EU FP7 project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149084
-
Breine, J.; Stevens, M.; Van den Bergh, E.; Maes, J. (2011). A reference list of fish species for a heavily modified transitional water: The Zeeschelde (Belgium) Belg. J. Zool. 141(1): 44-55
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=156540
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Eastern Atlantic: from Bergen (Norway) along the coasts of Europe to northern Mauritania in Africa (Ref. 188, Ref. 51442). Also in western part of Mediterranean Sea (Ref. 188). Reported from the western part of the Baltic Sea up to the Kaliningrad Oblast (Ref. 12801, 26334). Appendix III of the Bern Convention (protected fauna).
-
Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Physical Description
Morphology
Dorsal spines (total): 4 - 6; Dorsal soft rays (total): 13 - 18; Anal spines: 3 - 4; Analsoft rays: 18 - 24; Vertebrae: 57 - 58
-
Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Size
Max. size
83.0 cm TL (male/unsexed; (Ref. 7047)); max. published weight: 4,000 g (Ref. 30578); max. reported age: 10 years (Ref. 10536)
-
Billard, R. 1997 Les poissons d'eau douce des rivières de France. Identification, inventaire et répartition des 83 espèces. Lausanne, Delachaux & Niestlé, 192p. (Ref. 30578)
http://www.fishbase.org/references/FBRefSummary.php?id=30578&speccode=1696
-
Sabatié, M.-R. 1990 Croissance linéaire de l'alose vraie, Alosa alosa Linné, 1758 (Clupeidae), dans l'oued sebou (Façade nord-Atlantique du Maroc). Cybium 14(2):131-142. (Ref. 7047)
http://www.fishbase.org/references/FBRefSummary.php?id=7047&speccode=101
-
Quignard, J.-P. and C. Douchement 1991 Alosa alosa (Linnaeus 1758). p. 89-126. In H. Hoestlandt (ed.) The freshwater fishes of Europe. Vol. 2. Clupeidae, Anguillidae. AULA-Verlag Wiesbaden. (Ref. 10536)
http://www.fishbase.org/references/FBRefSummary.php?id=10536&speccode=101
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Diagnostic Description
Body somewhat compressed, fairly deep with depth at pectoral fin more than head length (Ref. 188, Ref. 51442). Upper jaw notched, lower jaw fitting into it (Ref. 188). Gill rakers long, thin and numerous, total 85 to 130, longer than gill filaments (Ref. 188). Large, thin scales (Ref. 51442). Presence of abdominal scutes (Ref. 51442). A dark spot posterior to gill opening (sometimes absent; occasionally 1 or 2 more spots) (Ref. 188).
-
Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
Habitat:
At sea, pelagic, in deep water down to 300 m. Juveniles remain close to shore and to estuaries. Migrates from sea upriver, spawning in main river or entering large and warm tributaries. Spawning sites often situated near a confluence.
Biology:
Anadromous. Males migrate upriver at 3-9 years. Females first reproduce 1-3 years later than males. Adults start approaching coasts at end of February and enter rivers when temperatures reach 10-12°C, usually in May. Spawning commences when temperature reaches 15°C. Optimal temperatures 22-24°C. Spawns in large, very noisy schools near surface at night. Eggs sink to bottom. Spent fish migrate back to sea, but most die after reproduction, having mated only once. Most juveniles migrate to river mouth during first summer and remain at sea until they mature. Individual fish are thought to return to their natal spawning site. At sea, feeds predominantly on plankton. In freshwater, adults do not feed and juveniles prey on insect larvae.
At sea, pelagic, in deep water down to 300 m. Juveniles remain close to shore and to estuaries. Migrates from sea upriver, spawning in main river or entering large and warm tributaries. Spawning sites often situated near a confluence.
Biology:
Anadromous. Males migrate upriver at 3-9 years. Females first reproduce 1-3 years later than males. Adults start approaching coasts at end of February and enter rivers when temperatures reach 10-12°C, usually in May. Spawning commences when temperature reaches 15°C. Optimal temperatures 22-24°C. Spawns in large, very noisy schools near surface at night. Eggs sink to bottom. Spent fish migrate back to sea, but most die after reproduction, having mated only once. Most juveniles migrate to river mouth during first summer and remain at sea until they mature. Individual fish are thought to return to their natal spawning site. At sea, feeds predominantly on plankton. In freshwater, adults do not feed and juveniles prey on insect larvae.
Systems
- Freshwater
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Depth range based on 93 specimens in 1 taxon.
Water temperature and chemistry ranges based on 59 samples.
Environmental ranges
Depth range (m): -9 - 169
Temperature range (°C): 7.038 - 11.889
Nitrate (umol/L): 2.055 - 11.851
Salinity (PPS): 32.945 - 35.503
Oxygen (ml/l): 5.719 - 6.579
Phosphate (umol/l): 0.356 - 0.817
Silicate (umol/l): 2.091 - 7.273
Graphical representation
Depth range (m): -9 - 169
Temperature range (°C): 7.038 - 11.889
Nitrate (umol/L): 2.055 - 11.851
Salinity (PPS): 32.945 - 35.503
Oxygen (ml/l): 5.719 - 6.579
Phosphate (umol/l): 0.356 - 0.817
Silicate (umol/l): 2.091 - 7.273
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 59 samples.
Environmental ranges
Depth range (m): -9 - 169
Temperature range (°C): 7.038 - 11.889
Nitrate (umol/L): 2.055 - 11.851
Salinity (PPS): 32.945 - 35.503
Oxygen (ml/l): 5.719 - 6.579
Phosphate (umol/l): 0.356 - 0.817
Silicate (umol/l): 2.091 - 7.273
Graphical representation
Depth range (m): -9 - 169
Temperature range (°C): 7.038 - 11.889
Nitrate (umol/L): 2.055 - 11.851
Salinity (PPS): 32.945 - 35.503
Oxygen (ml/l): 5.719 - 6.579
Phosphate (umol/l): 0.356 - 0.817
Silicate (umol/l): 2.091 - 7.273
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Habitat
Coastal waters returning to freshwater to spawn above gravel substrates. Alosa alosa has been reported in depths ranging from 10 -150 m.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Environment
pelagic-neritic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 5 - ? m
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Migration
Introduction
This species has been introduced or released in Dutch waters.
-
Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=73
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Trophic Strategy
Strongly migratory species, penetrating far up rivers, but not into small tributaries, to spawn (Ref. 188). Feeds on planktonic crustaceans and fish (Ref. 188, Ref. 51442).
-
Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Life History and Behavior
Life Cycle
Enters rivers in May (spring) to spawn, usually at night in moving waters (Ref. 188). Spawners swarm at the site at dusk, couples side by side swimming in circles and hitting the surface of the water with their caudal fins (Ref. 5744). Eggs and sperm are expulsed in this movement (Ref. 5745). A majority of the spawners die after spawning, survivors return to sea (Ref. 188, Ref. 51442).
-
Allardi, J. and P. Keith 1991 Atlas préliminaire des poissons d'eau douce de France. Coll. Patrimoines Naturels, vol. 4. Secrétariat Faune Flore, Muséum national d'Histoire naturelle, Paris. 234 p. (Ref. 2163)
http://www.fishbase.org/references/FBRefSummary.php?id=2163&speccode=101
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Alosa alosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC3534-07|AP009131|Alosa alosa| ACACGTTGATTTTTCTCAACTAATCATAAAGATATTGGTACCCTTTACCTAGTATTTGGTGCCTGAGCAGGGATAGTAGGCACTGCCTTA---AGTCTCTTAATCCGAGCCGAACTGAGCCAACCCGGGGCACTTCTCGGAGAT---GATCAGATCTATAACGTCATCGTTACGGCGCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATTCTAATTGGCGGCTTTGGGAATTGACTAGTCCCCCTTATG---ATCGGGGCACCAGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGGCTACTTCCACCCTCATTCCTCCTCCTCCTTGCCTCCTCCGGGGTTGAAGCCGGGGCAGGGACCGGGTGAACAGTCTACCCGCCTTTGGCAGGCAATCTTGCCCACGCCGGGGCATCCGTCGACCTG---ACTATCTTCTCTCTTCATCTAGCAGGTATTTCATCGATTCTTGGGGCCATTAATTTTATTACCACAATCATTAATATGAAACCCCCTGCAATCTCACAATATCAAACACCCCTATTTGTGTGATCCGTGCTTGTAACGGCCGTTCTCCTTCTTCTCTCACTCCCTGTGCTAGCTGCT---GGGATTACAATGCTCCTAACAGACCGAAATCTAAATACAACCTTCTTTGACCCGGCAGGGGGAGGGGACCCAATTTTATACCAACACCTATTCTGATTCTTCGGCCACCCGGAAGTTTATATTTTAATCCTGCCAGGATTTGGAATGATCTCCCACATTGTAGCCTATTATTCCGGCAAAAAG---GAACCTTTCGGATACATGGGGATGGTGTGAGCCATGATGGCCATCGGACTTCTAGGGTTTATTGTATGAGCCCACCACATGTTTACCGTGGGGATAG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Alosa alosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1
Public Records: 2
Species: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2008
Assessor/s
Freyhof, J. & Kottelat, M.
Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)
Contributor/s
Justification
Presently only very locally distributed outside France. In the past it has been a victim of pollution, impoundment of large rivers and overfishing throughout Europe. However, most populations declined during first decades of 20th century and it now seems to have stabilised at a low or medium level in recent times.
History
- 1996Data Deficient
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Trends
Population
Population
Population Trend
Currently large populations in France. Has declined outside France, mainly in the early 1900s, almost extirpated in Germany due to pollution in the 1920's (Freyhof pers comm.).
Population Trend
Unknown
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Threats
Threats
Major Threats
Overfishing, pollution and dam constructions (cutting off access to spawning sites). Gravel extraction in France is a current threat to the species.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Least Concern (LC)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Management
Conservation Actions
Conservation Actions
Fish passes and elevators in France allow access to spawning sites. It is a (EU - Berne Convention) Natura 2000 species, requiring protection from range states.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; gamefish: yes
-
Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial coldwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p. (Ref. 9988)
http://www.fishbase.org/references/FBRefSummary.php?id=9988&speccode=2065
-
Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
http://www.fishbase.org/references/FBRefSummary.php?id=4931&speccode=228
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Wikipedia
Allis Shad
The allis shad (Alosa alosa) is a species of fish in the Clupeidae family.[1]
Contents |
Location
It is found in most of Europe and northwestern Africa. [1]
Biology and Life-cycle
Alosa alosa has a similar lifecycle to twait shad Alosa fallax. They are known to live in sympatry with Alosa fallax. [2] Some studies have suggested that the Alosa fallax and Alosa alosa species can hybridize.[3] They are anadromous species just like many other species in the Alosa genus.[3] However, there is some record of them being landlocked, suggesting an ability to adapt well to their environment. [3] They primarily live at sea on feeding grounds and will migrate to their spawning grounds between April and June once they are sexually mature.[3] Maturity usually ranges from 3-7 years of age.[3] Alosa alosa can usually only reproduce once in their lifetime.[3] It is observed that juvenilles appear in estruaries, brackish water, around July to August.[2] The salinity of brackish water may impose problems to the juveniles migrating from freshwater.[2]
Population Reduction
Populations have been reduced primarily by overfishing, pollution, and habitat destruction.[3] Hybridization between species is more likely with species affected by human disturbances.[3] It is estimated that the estuarine phase, or the time that they are in the estuaries migrating from spawning grounds to sea, has a duration in Alosa alosa of up to six months.[2] The estimate however does not take into account individual variation and/or survival of juveniles in the estuarine phase.[2]
Conservation
Four special areas of conservation have been designated in Ireland where Alosa species have been known to spawn.[3] Alosa alosa "has been placed in Appendix III of the Bern Convention (1979) that lists protected fauna species as well as in Appendix II and V of the European Community Habitats Directive (1992) that list, respectively, species whose conservation requires the designation of special areas of conservation and that are subject to management measures.” [2] However, Alosa alosa are currently under a moratorium (2008) in numerous French watersheds. [2]
Sources
- ^ a b Freyhof, J. & Kottelat, M. 2008. Alosa alosa. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. <www.iucnredlist.org>. Downloaded on 16 December 2011.
- ^ a b c d e f g Lochet, A., S. Boutry, and E. Rochard. Estuarine Phase during Seaward Migration for Allis Shad Alosa Alosa and Twaite Shad Alosa Fallax Future Spawners. Ecology of Freshwater Fish 18 (2009): 323-35.
- ^ a b c d e f g h i Coscia, I., V. Rountree, J. J. King, W. K. Roche, and S. Mariani. A Highly Permeable Species Boundary between Two Anadromous Fishes. Journal of Fish Biology DOI:10.1111/j.1095-8649.2010.02768.x 77.5 (2010): 1137-149.
Source:
Wikipedia
Unreviewed
