Overview

Brief Summary

Biology

Despite its docile nature during the day this nocturnal shark can become aggressive when hunting at night, thrashing through coral reefs looking for potential prey. The whitetip reef shark usually hunts alone, but is non-territorial and will occasionally work in cooperation with others in the pursuit of prey (3). Feeding primarily on bottom-dwelling octopus, lobsters, crabs and bony fish, it often chases its prey into a crevice before jamming its body in after it, sealing the exit (4). The extremely posterior location of the first dorsal fin compared to those of other sharks is an adaptation to this feeding habit, which allows them to get their heads and mouths much further into the gaps and holes in the coral (5). The whitetip reef shark's mating season varies with location (4). Reproduction is viviparous and after a gestation period of around a year (5) the female will give birth to one to five live pups, which are completely independent at birth (3). Both sexes reach sexual maturity at approximately 5 years old, and it is estimated that this species can live to an age of 25 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Lifestyle

You may know that most sharks need to move to keep breathing, but the white-tip reef shark can afford to be lazier than that. During the day, it likes to rest in a cave or under a coral ledge, pumping water across its gills so it can breathe. That relaxation time pays off at night, when it hunts, chasing after its prey at great speeds, letting nothing get in its way! It usually hunts alone, but sometimes it will hunt with other reef sharks.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The whitetip reef shark earns its common name from the conspicuous white tips found on the first dorsal and upper caudal fins, occasionally found also on the second dorsal and lower caudal fins (4) (5). Small dark spots are scattered across the body, which is grey-brown in colour, fading to white on the underside (4). This small shark is moderately slender with a broad and flattened head, rounded snout, down-slanted mouth and large eyes (3) (4). The whitetip reef shark can be distinguished from the similar silvertip (Carcharhinus albimarginatus) and oceanic whitetip (Carcharhinus longimanus) sharks by being much smaller and more slender, by lacking the white tips these two sharks have on the pectoral fins, and by possessing a second dorsal fin that is significantly larger than in these two species (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Sluggish inhabitant of lagoons and seaward reefs where it is often found resting in caves or under coral ledges during the day (Ref. 6871, 58302), or usually on a sand patch, or in a channel (Ref. 37816). More active at night or during slack tide in areas of strong currents (Ref. 37816). Feeds on benthic animals such as fishes, octopi, spiny lobsters and crabs (Ref. 244). Viviparous (Ref. 50449). Travels distances from about 0.3 to 3 km in periods up to about 1 year (Ref. 244). Rarely reported to attack humans, but is potentially dangerous especially when fish had been speared (Ref. 244). Probably fished wherever it occurs (Ref. 244). Caught by inshore longline and gillnet fisheries, and probably adversely affected by dynamite fishing (Ref.58048). Meat and liver utilized fresh for human consumption (Ref. 244). The liver of this shark has been reported as toxic (Ref. 583). One to five 60 cm young per litter (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol), puntiblanco (Espanol)
 
Triaenodon obesus (Rüppell, 1837)


Whitetip reef shark



Body fairly slender; head broad, blunt and flattened, wedge shaped when viewed from above; eyes small; usually no spiracles; front flaps on nostrils tubular; top and bottom front teeth with one large, triangular, slightly oblique point and a small point on base at each side of that; five gill slits, last 1-2 over pectoral; first dorsal origin nearer pelvics than pectoral; second dorsal large, but smaller than first, origin ~ over origin of equal-sized anal; no ridge between dorsals; pectoral large, triangular; pit on top of base of tail; tail strongly asymmetric, large lower lobe, upper lobe notched under point.


Brownish grey, shading to whitish with a yellow cast ventrally, usually with a few scattered roundish dark grey spots on body (more on bottom half than top); tips of first dorsal fin and upper caudal lobe broadly white; tips of second dorsal fin and lower lobe of caudal fin also often white.


Maximum size 213 cm.

Spends most of the day at rest on the bottom in caves or beneath ledges; a seemingly curious shark that often approaches divers at close range.

Depth: 2-300 m.



Indo-Pacific; the mouth of the Gulf of California to Colombia; all the oceanic islands except Clipperton.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The white-tip reef shark is one of the most common sharks on a reef. Though it is smaller and less violent than the tiger shark, it is still a top predator on the reef. It has very thick, tough skin, a flat head, and a dorsal fin (the fin on its back) that is far away from its head. Because of these three things, it can stick its head into gaps in the hard coral and other tight spots to find food.

Its color pattern helps it sneak up on fish: when seen from below, its light-colored stomach blends with the bright, sunny waters above, and when seen from above, its dark back matches the ocean floor. This color scheme, called countershading, is sported by most sharks.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to Indonesia and the Arafura Sea (Ref. 9819), north to Ryukyu and Ogasawara islands, south to New South Wales (Australia), New Caledonia, and the Austral and Pitcairn islands; throughout Micronesia. Eastern Pacific: Cocos and Galapagos islands, Panama to Costa Rica.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Whitetip Reef Shark is wide ranging in the Indo-Pacific. It occurs along the east coast of Africa from South Africa to Red Sea, Indian Ocean islands, northern Indian Ocean, including India, Sri Lanka, Myanmar, Vietnam, the Philippines, Australia, New Guinea and Polynesia, Melanesia, Micronesia to the Hawaiian Islands and Pitcairn group. The species is also found in the eastern Pacific, Cocos Islands, Galapagos and Panama to Costa Rica (Compagno 1984b). It is found in shallow tropical waters from about 1 m down to 330 m depth, but mainly between 10?40 m (Randall 1977).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The whitetip reef shark in found in both the Indian and Pacific oceans. They exist as far west as the coasts of South Africa and Sri Lanka in the Indian Ocean and can be seen as far east as the coasts of Costa Rica and Panama in the Pacific Ocean. They are most prominent in the Indo-Pacific seas and around the southern coast of the Indian sub-continent. Fossils have been found in North Carolina from the Miocene epoch indicating that the shark existed in the Atlantic Ocean several million years ago; however they not currently found in the Atlantic Ocean.

Biogeographic Regions: oriental (Native ); indian ocean (Native ); pacific ocean (Native )

  • Compagno, L. 1984. FAO species catalogue. Vol. 4. Sharks of the World. An Annotated and illustrated catalogue of shark species known to date. Part 2. Carcharhiniformes.. Grahamstown, South Africa: FAO Fish.Synop..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Panama, north to Ryukyu Islands and Ogasawara Islands, south to New South Wales (Australia), New Caledonia and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 2 (S) - 300 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The whitetip reef shark is found widely throughout the Indian and Pacific Oceans. It occurs as far west as the coast of South Africa in the Indian Ocean and as far east as the coast of Costa Rica and Panama in the Pacific Ocean (3). Now found in Mexican waters as well (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The whitetip reef shark is a medium-sized shark averaging about 1.6 meters in length and 20 kg in mass, but growing as big as 2 meters and 28 kg. It is grey in color with a white belly and characteristic white tips on its first dorsal, upper caudal and occasionally the pelvic fins. The snout is short and broad with a mouth full of smooth edged teeth on both jaws. Both the mouth and nostrils are located on the underside of the head. The skin is very tough and the lateral fins are highly flexible. Both of these characteristics allow them to exist more easily among the rough and jagged edges of a coral reef. A diagnostic feature that distinguishes Triaenodon obesus from the similar silvertip and oceanic whitetip sharks is the second dorsal fin. In the whitetip reef shark it is significantly larger in comparison to the other species.

Range mass: 27.7 (high) kg.

Average mass: 20 kg.

Range length: 213 (high) cm.

Average length: 165 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • Perrine, D. 1995. Sharks. Stillwater, Minnesota, USA: Voyageur Press.
  • Randall, J. 1977. Contribution to the Biology of the Whitetip Reef Shark (Triaenodon obesus). Pacific Science, 31/2: 143-164.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 213.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

213 cm TL (male/unsexed; (Ref. 244)); max. published weight: 18.3 kg (Ref. 4699); max. reported age: 25 years (Ref. 6807)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A small, slender shark with an extremely short, broad snout, oval eyes, and conspicuous white tips on the 1st dorsal (sometimes 2nd) and upper caudal fins; 2nd dorsal almost as large as 1st; no interdorsal ridge (Ref. 5578). Spiracles usually present, teeth 47-50/ 44-46, in at least 2 functional rows. Grey above, lighter below and sometimes with dark spots on sides (Ref. 5578). First dorsal-fin lobe and dorsal caudal-fin lobe with conspicuous white tips, second dorsal-fin lobe and ventral caudal-fin lobe often white-tipped (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Sluggish inhabitant of lagoons and seaward reefs. Also found in caves and fissures. Feeds on fishes, octopuses, spiny lobsters and crabs. Not territorial. Travels distances from about 0.3 to 3 km in periods up to about 1 year. Viviparous, with 1 to 5 young per littter. Born at about 45 cm (Ref. 5485). Rarely reported to attack humans, but is potentially dangerous especially when fish had been speared. Used for human consumption. The liver of this shark has been reported as toxic (Ref. 583).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 330 m (Ref. 244), usually 8 - 40 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Whitetip Reef Sharks are closely associated with coral reefs in clear, tropical waters. Primarily nocturnal, they shelter in caves by day, often communally. They often return to a home cave for periods of days, weeks or more (Randall 1977). Active at night, they hunt fish and other prey, often in caves and crevices. Maturity is attained at about 105 cm, although a mature male of 95 cm and a pregnant female of 102 cm have been recorded in the Maldives (Anderson and Ahmed 1993). Mating has been recorded in the wild by Tricas and Le Feuvre (1985) and pups are born at 52?60 cm after a gestation period of at least five months. Litter size has been recorded as 2?3 in Madagascar (Fourmanoir 1961, Last and Stevens 1994) and 1?5 elsewhere (Randall 1977, Last and Stevens 1994).

Growth is slow in the wild, estimated at 2.1?4.2 cm year-1 (Randall 1977), and they may attain sexual maturity at eight to nine years and live to about 16 years (Randall 1977, Smith et al. 1998). Maximum size is around 200 cm TL but adults are very rare over 160 cm (Compagno in prep. b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Triaenodon obesus is a reef shark as its name would indicate and lives in or around coral reefs. These reef settings are in tropical, coastal waters. Being a nocturnal animal, it spends much of the day in caves and deep crevices in coral reefs or coral reef lagoons. Whitetip reef sharks share these habitats with other reef sharks. However each species takes on a particular location within the reef system. The blacktip reef shark takes the shallow, high-energy coastal waters. The grey reef shark takes the deeper clear waters off the reef edge. The whitetip reef shark is the shark that lives in among the coral reefs, most commonly between the depths of 8 and 40 meters.

Range depth: 1 to 330 m.

Average depth: 8-40 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: benthic ; reef ; coastal

Other Habitat Features: caves

  • Bright, M. 2002. Sharks. Washington, D.C.: Smithsonian Institution Press.
  • 2004. Biology of Sharks and Their Relatives. Pp. 53, 74, 277, 281, 354 in J Carrier, J Musick, M Heithaus, eds. Biology of Sharks and Their Relatives. Boca Raton: CRC Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 78 samples.

Environmental ranges
  Depth range (m): 6 - 94
  Temperature range (°C): 24.485 - 28.575
  Nitrate (umol/L): 0.057 - 6.688
  Salinity (PPS): 33.044 - 35.469
  Oxygen (ml/l): 3.591 - 4.743
  Phosphate (umol/l): 0.116 - 0.637
  Silicate (umol/l): 0.567 - 10.063

Graphical representation

Depth range (m): 6 - 94

Temperature range (°C): 24.485 - 28.575

Nitrate (umol/L): 0.057 - 6.688

Salinity (PPS): 33.044 - 35.469

Oxygen (ml/l): 3.591 - 4.743

Phosphate (umol/l): 0.116 - 0.637

Silicate (umol/l): 0.567 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 330m.
From 1 to 330 meters.

Habitat: reef-associated. Blunthead shark.  (Ruppell, 1837) Vivaparous 1-5 pups. Attains 1.6 Metres. Occasionly aggressive to man when fish have been speared.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As its name indicates, this shark is a reef shark that typically lives along the bottom of clear tropical waters near coral reefs, where it rests in aggregations in caves during the day and feeds at night (3) (4). It prefers shallow waters but has been reported at depths of 330 meters, although this has not been confirmed (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154). Fees on fish and mollusks (Ref. 568). Frequently inhabits coral reefs of the IndoPacific Region (Ref. 9137). Cleaned by Elacatinus puncticulatus (Ref. 35860).
  • Wetherbee, B.M., S.H. Gruber and E. Cortes 1990 Diet, feeding habits, digestion, and consumption in sharks, with special reference to the lemon shark, Negaprion brevirostris. p. 29-47. In H.L. Pratt, Jr., S.H. Gruber and T. Taniuchi (eds.) Elasmobranchs as living resources: advances in the biology, ecology, systematics, and the status of the fisheries. NOAA Tech. Rep. NMFS 90. 517 p. (Ref. 568)   http://www.fishbase.org/references/FBRefSummary.php?id=568&speccode=139 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Despite the docile nature of this shark during the day, during feeding at night they become very aggressive. It will thrash through coral reefs looking for food. The whitetip reef shark usually hunts alone but will work with other sharks to pursue prey throughout the coral reefs. Sometimes in pursuit of a fish, the shark will wedge the front half of its body into a crack or crevice on the reef and stay there until it catches the fish. The whitetip reef shark is considered clumsy and slow in open water, however it is still considered a pelagic predator. It is capable of catching fish in coral reefs because of its maneuverability. Despite its ability to catch fish, it specializes in bottom feeding. Its ventrally located mouth is ideal for picking crab, lobster and octopi off the sea floor, but its primary source of food is several types of boney fishes including but not restricted to damselfish (Pomacentridae), parrotfish (Scaridae), surgeonfish (Acanthuridae), goatfish (Mullidae), triggerfish (Balistidae), squirrelfish (Holocentridae) and eels (Anguilliformes).

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Russo, R. 1984. Whitetip - the cave shark. Sea Frontiers, 30/1: 30-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The whitetip reef shark uses the coral reefs as a habitat, as well as a source for food. They are important predators in reef ecosystems. The sharks’ predation of fishes may serve as a sort of population control. This is particularly important in those fishes, such as the parrotfish, that consume the coral.

However the whitetip reef shark does occasionally have a negative effect on the coral. These sharks sometimes damage corals in their aggressive pursuit of prey fish.

The whitetip reef shark also serves as host to small cleaner fish such as gobies or striped cleaner wrasses who feed on the parasites infesting the shark.

Mutualist Species:

  • cleaner fish

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The most dangerous predator of the whitetip reef shark is humans. However, in the ocean they can be prey for large carcharhinid sharks, such as the tiger shark (Galeocerdo cuvier) or the silvertip shark (Carcharhinus albimarginatus).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

The white-tip reef shark eats meat! It eats lobsters, octopi, and medium to large fish. Because it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As with most sharks the main form of perception is visual. Sharks in general tend to have good eyesight especially in dim light. The eyes are large and oval in shape. The large eyes are particularly useful to the whitetip because it is a nocturnal animal that does most of its hunting and traveling at night.

Like other sharks, they have very strong chemosensory systems as well. This is most useful to the whitetip reef sharks in hunting and eating.

Whitetip reef sharks respond to sounds in the water. They are believed to be attracted to the sounds of spearfishing in the water.

Like other sharks, this species also has electroreceptive abilities to help them detect prey.

Very little is known about the communication of these sharks with each other. It is known that they do share caves, and occasionally hunt together, however the way in which they communicate isn’t fully understood. One case in which the communication is obvious is in mating where there is a clear tactile communication in the act of the male biting the fins of the female.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Viviparous, placental (Ref. 50449), with 1 to 5 young per litter (Ref. 244); usually 2 or 3 pups after a gestation period of > 5 months (Ref.58048). Size at birth 52-60 cm TL (Ref. 9997). Distinct pairing with embrace (Ref. 205).During courtship and prior to copulation, the male bites the female on her right pectoral fin and uses his medially flexed right clasper in copulation (Ref. 49562, 51119). During copulation which lasts from 15 seconds to 4 minutes (Ref. 49562, 51119), both heads of the male and female are slammed in the substrate and their bodies undulate to keep their tails elevated (Ref. 51155). This mating behavior was observed in individuals bred in captivity.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

The embryos are maintained in the mother for 5 months. They are then born alive and fully functional. The new-born juveniles are a mini-version of an adult whitetip reef shark, capable of surviving on their own. They grow relatively slowly however, and reach sexual maturity five years later.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The whitetip reef shark is believed to live to a maximum of 25 years.

Range lifespan

Status: wild:
25 (high) years.

Average lifespan

Status: captivity:
25 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male whitetip reef sharks have been known to school in groups of nearly a hundred in pursuit of a female ready to mate. Mating in this particular species happens in autumn and winter. The sharks orient themselves parallel to each other and at about a 45 degree angle to the water column during copulation. They position themselves with their snouts in the sea floor, maintaining this vertical position with occasional simultaneous undulations of their bodies. The male then bites the pectoral fin of the female and inserts his clasper into the cloaca. This ritual of biting the female’s pectoral fin to hold position is common to several species.

Once the female is pregnant, the gestation period is thought to be about 5 months, however more research is needed in this area. The female gives birth to 2 or 3 live sharks of about 60 cm each.

Breeding interval: There is not sufficient evidence to indicate how often this species breeds.

Breeding season: Fertilization occurs seasonally in autumn and winter. This is between May and August in the Southern Hemisphere.

Range number of offspring: 1 to 5.

Average number of offspring: 2-3.

Average gestation period: 5 months.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average age at sexual or reproductive maturity (female)

Sex: female:
2920 days.

Because the whitetip reef shark is a viviparous species it gives birth to live young. While in the embryo stage, the juvenile receives all its nutrients from the mother via a yolk sac placenta. The female shark, having a litter of young sharks within her, is slower and less maneuverable making her more vulnerable to predators. All of the parental investment in this species is by the female, and it is all internal in embryo stage. Once the juveniles are born, they are completely independent and capable of fending for themselves.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Bright, M. 2002. Sharks. Washington, D.C.: Smithsonian Institution Press.
  • Perrine, D. 1995. Sharks. Stillwater, Minnesota, USA: Voyageur Press.
  • Compagno, L. 1984. FAO species catalogue. Vol. 4. Sharks of the World. An Annotated and illustrated catalogue of shark species known to date. Part 2. Carcharhiniformes.. Grahamstown, South Africa: FAO Fish.Synop..
  • Tricas, T., E. Feuvre. 1985. Mating in the reef white-tip shark Triaenodon obesus. Marine Biology, 84/3: 233-237.
  • 2004. Biology of Sharks and Their Relatives. Pp. 53, 74, 277, 281, 354 in J Carrier, J Musick, M Heithaus, eds. Biology of Sharks and Their Relatives. Boca Raton: CRC Press.
  • SeaWorld Inc., 2002. "Sharks And Their Relatives" (On-line). Accessed November 19, 2004 at http://www.seaworld.org/infobooks/Sharks&Rays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Triaenodon obesus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGACAACCTGGATCTCTTTTAGGAGATGATCAGATCTATAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTTGGAAATTGACTAGTTCCCTTAATAATTGGTGCACCAGACATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTTGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGATGAACAGTCTATCCTCCATTGGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACTATTATCAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTCGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTTTCACTCCCAGTTCTTGCAGCAGGAATTACAATATTACTTACTGATCGTAACCTTAATACTACATTCTTTGACCCTGCAGGTGGGGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Triaenodon obesus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Smale, M.J.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Whitetip Reef Shark (Triaenodon obesus) has a widespread distribution in tropical and subtropical Indian and Pacific Oceans. The species is commonly found between 10–40 m around coastal reefs, divers frequently see it resting in caves by day; it is most common in areas of high relief coral and caves. Formally it was abundant over coral reefs, these sharks' numbers are at lower levels than those found prior to widespread expansion of fishing in the past 20 years. The species' restricted habitat, depth range, small litter size and moderately late age at maturity suggest that with increasing fishing pressure this species may become threatened.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are no special conservation projects involving the whitetip reef shark. It currently has a wide tropical distribution. However, it's slow rate of reproduction would make it very vulnerable to over-fishing. The IUCN rates the species "Lower Risk/Not Threatened."

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Taken in line and net trawl fisheries operating in shallow reef areas, this shark has been recorded as part of the multi-species shark catch taken by tropical fisheries, e.g. Barnett (1996), Hayes (1996) and Keong (1996). Although its life history pattern suggests a moderate capacity for rebound (Smith et al. 1998), heavy fishing pressure inshore and lack of management plan in most places suggest that this species may be under threat in heavily fished areas, including remote tropical reefs (Anderson et al.1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Though white-tip reef sharps are eaten by larger sharks on the reef, humans are their biggest threats. People hunt them for their meat and liver. If humans kill too many, they could disappear from reefs entirely. Some people kill them because they are afraid, but white-tips aren’t dangerous to humans; they’re just curious about their human visitors, such as reef-divers and spearfishers. White-tips don’t like to eat us, only fish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The whitetip reef shark is fished in the waters off Pakistan, India, Sri Lanka and Madagascar (4). It is also believed to be fished in other waters across its range, but data is limited. The meat and liver are sold for human consumption, despite the liver being reported as toxic (6). Although this reef shark is widely distributed, its restricted habitat, depth range, small litter size, and moderately late age at maturity mean that its rebound potential is low and it may become increasingly threatened with rising fishing pressure (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific management or conservation plans are known to exist for this species and it must be regarded as potentially under threat from continuing tropical multi-species fisheries. Marine reserves of appropriate size and locality could protect this species, given the pattern of residency shown by Randall (1977). Its distribution in clear waters over coral reefs makes this species ideal for non-consumptive use in the form of tourism diving, as has been shown in a preliminary analysis by Anderson and Ahmed (1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The whitetip reef shark is widespread and relatively abundant and there is no legislation against fishing this animal (3). The whitetip reef shark project of Hawaii is currently researching this shark's life history, movement patterns and habitat utilisation in the hope that this will help in the future management of populations (7). The Food and Agriculture Organisation of the United Nations (FAO) have been working for years on an International Plan of Action for the conservation and management of sharks throughout the world (IPOA-SHARKS) (8). However, the vast size of the oceans where the whitetip reef shark resides and the difficulty of law enforcement in many areas make the task of managing the conservation of this beautiful shark extremely difficult (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The whitetip reef shark is only a problem to humans if provoked. They are considered to be a passive, calm animal that is easily approachable by divers. A whitetip reef shark will also attack in defense if escape is not an option. Altercations with spear fisherman can occur; most commonly in dispute over possession of the speared fish. It is thought that the sound of spear fishing arouses the shark, and therefore results in their abandonment of the cave and eventual pursuit of the speared fish.

Although the flesh of these sharks is sometimes eaten for food, there are reports that the tissues, particularly the liver, may be toxic.

Negative Impacts: injures humans (bites or stings, poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans will consume the whitetip reef shark; in particular they use the fins in soup.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Whitetip reef shark

The whitetip reef shark (Triaenodon obesus) is a species of requiem shark, family Carcharhinidae, and the only member of its genus. A small shark usually not exceeding 1.6 m (5.2 ft) in length, this species is easily recognizable by its slender body and short but broad head, as well as tubular skin flaps beside the nostrils, oval eyes with vertical pupils, and white-tipped dorsal and caudal fins. One of the most common sharks found on Indo-Pacific coral reefs, the whitetip reef shark occurs as far west as South Africa and as far east as Central America. It is typically found on or near the bottom in clear water, at a depth of 8–40 m (26–130 ft).

During the day, whitetip reef sharks spend much of their time resting inside caves. Unlike other requiem sharks, which rely on ram ventilation and must constantly swim to breathe, this shark can pump water over its gills and lie still on the bottom. At night, whitetip reef sharks emerge to hunt bony fishes, crustaceans, and octopus in groups, their elongate bodies allowing them to force their way into crevices and holes to extract hidden prey. Individuals may stay within a particular area of the reef for months to years, time and again returning to the same shelter. This species is viviparous, in which the developing embryos are sustained by a placental connection to their mother. One of the few sharks in which mating has been observed in the wild, receptive female whitetip reef sharks are followed by prospective males, which attempt to grasp her pectoral fin and maneuver the two of them into positions suitable for copulation. Females give birth to one to six pups every other year, after a gestation period of 10–13 months.

Whitetip reef sharks are rarely aggressive towards humans, though they may investigate swimmers closely. However, spear fishers are at risk of being bitten by one attempting to steal their catch. This species is caught for food, though ciguatera poisoning resulting from its consumption has been reported. The IUCN has assessed the whitetip reef shark as Near Threatened, noting its numbers are dwindling due to increasing levels of unregulated fishing activity across its range. The slow reproductive rate and limited habitat preferences of this species renders its populations vulnerable to overfishing.

Contents

Taxonomy and phylogeny [edit]

Early illustration of a whitetip reef shark from Systematische Beschreibung der Plagiostomen (1841).

The whitetip reef shark was first described by the German naturalist Eduard Rüppell as Carcharias obesus, in the 1837 Fische des Rothen Meeres (Fishes of the Red Sea).[2] His choice of the specific epithet obesus was curious, given that this shark is actually quite slender.[3] Later in 1837, Johannes Müller and Friedrich Henle moved this species into its own genus Triaenodon, from the Greek triaena meaning "trident", and odon meaning "tooth". As Rüppell did not originally designate a holotype, in 1960 a 31-cm-long specimen caught off Jeddah, Saudi Arabia, was made the species lectotype.[2] Other common names for this shark include blunthead shark, light-tip shark, reef whitetip shark, and whitetip shark.[4]

Once placed in the family Triakidae, the whitetip reef shark is now recognized by most authors as belonging to the family Carcharhinidae on the basis of morphological characters, such as a full nictitating membrane, well-developed precaudal pit, strong lower caudal fin lobe, and scroll-like intestinal valves.[5] Morphological and molecular phylogenetic analyses suggest the whitetip reef shark is grouped with the lemon sharks (Negaprion) and the sliteye shark (Loxodon) in occupying an intermediate position on the carcharhinid evolutionary tree, between most basal genera (Galeocerdo, Rhizoprionodon, and Scoliodon) and the most derived (Carcharhinus and Sphyrna).[6]

Distribution and habitat [edit]

Photo of a whitetip reef shark resting amongst many brightly colored corals, its head concealed in a cave
The whitetip reef shark almost exclusively inhabits coral reefs.

The whitetip reef shark is distributed widely across the entire Indo-Pacific region. In the Indian Ocean, it occurs from northern KwaZulu-Natal, South Africa to the Red Sea and the Indian subcontinent, including Madagascar, Mauritius, the Comoros, the Aldabra Group, the Seychelles, Sri Lanka, and the Chagos Archipelago. In the western and central Pacific, it is occurs from off southern China, Taiwan, and the Ryukyu Islands, to the Philippines, Southeast Asia, and Indonesia, to northern Australia, and is also found around numerous islands in Melanesia, Micronesia, and Polynesia, as far as Hawaii to the north and the Pitcairn Islands to the southeast. In the eastern Pacific, it occurs from Costa Rica to Panama, and off the Galápagos Islands.[2]

Associated almost exclusively with coral reef habitats, whitetip reef sharks are most often encountered around coral heads and ledges with high vertical relief, and additionally over sandy flats, in lagoons, and near drop-offs to deeper water.[7] They prefer very clear water and rarely swim far from the bottom.[5] This species is most common at a depth of 8–40 m (26–130 ft).[2] On occasion, they may enter water less than 1 m deep, and there is an exceptional record of a whitetip reef shark being captured from a depth of 330 m (1,080 ft) in the Ryukyu Islands.[5]

Description [edit]

Frontal view of a whitetip reef shark, which has a wedge-shaped snout, oval eyes, and tubular flaps of skin next to the nostrils
The "face" of a whitetip reef shark is distinctive, with a broad snout, tubular nasal flaps, and oval eyes with vertical pupils.

A relatively small species, few whitetip reef sharks are longer than 1.6 m (5.2 ft). The maximum length this species attains is often given as 2.1 m (6.9 ft), though this was originally based on visual observations and may be dubious.[5] The maximum reported weight is 18.3 kg (40 lb).[4] The whitetip reef shark has a slim body and a short, broad head. The snout is flattened and blunt, with large flaps of skin in front of the nares that are furled into tubes. The eyes are small and oval with vertical pupils and prominent ridges above, and are often followed by a small notch. The mouth has a distinct downward slant (imparting a disgruntled expression to the shark), with short furrows at the corners. There are 42–50 tooth rows in the upper jaw and 42–48 tooth rows in the lower jaw. Each tooth has a single narrow, smooth-edged cusp at the center, flanked by a pair of much smaller cusplets.[2]

The first dorsal fin is positioned well back on the body, closer to the pelvic than the pectoral fins. The second dorsal and anal fins are large, about half to three-quarters as high as the first dorsal fin. The broad, triangular pectoral fins originate at or slightly before the level of the fifth gill slit. There is no ridge between the first and second dorsal fins. The lower lobe of the caudal fin is half the length of the upper, which has a strong notch near the tip.[2] The dermal denticles are small and overlapping, usually with 7 horizontal ridges, giving the skin a smooth feel. The coloration is grayish to brownish above and white below, with a pattern of scattered small, dark spots unique to each individual. The tips of the first dorsal fin and upper caudal fin lobe, and sometimes also the second dorsal fin and lower caudal fin lobe, are bright white.[5]

Biology and ecology [edit]

Three gray sharks lying beside each other on the sea bottom.
Whitetip reef sharks spend much of the day lying still on the bottom.

The whitetip reef shark is one of the three most common sharks inhabiting the reefs of the Indo-Pacific, the other two being the blacktip reef shark (Carcharhinus melanopterus) and the grey reef shark (Carcharhinus amblyrhynchos). The habitat preferences of this species overlap those of the other two, though it does not tend to frequent very shallow water like the blacktip reef shark, nor the outer reef like the grey reef shark.[2] The whitetip reef shark swims with strong undulations of its body, and unlike other requiem sharks can lie motionless on the bottom and actively pump water over its gills for respiration.[2] This species is most active at night or during slack tide, and spends much of the day resting inside caves singly or in small groups, arranged in parallel or stacked atop one another. Off Hawaii, these sharks may be found sheltering inside underwater lava tubes, while off Costa Rica they are often seen lying in the open on sandy flats.[8]

Whitetip reef sharks generally remain within a highly localized area; only rarely do they undertake long movements, wandering for a while before settling down somewhere new. One study at Johnston Atoll found that none of the sharks examined had moved more than 3 km (1.9 mi) away from their original capture location over periods of up to a year.[5] Another study at Rangiroa Atoll in French Polynesia found that, after more than three years, around 40% of the originally tagged sharks were still present on the same reef where they were first captured. An individual shark may rest inside the same cave for months to years. The daytime home range of a whitetip reef shark is limited to approximately 0.05 km2 (0.019 sq mi); at night this range increases to 1 km2 (0.39 sq mi).[8] These sharks are not territorial and share their home ranges with others of their species; they do not perform threat displays.[2][7]

Important predators of the whitetip reef shark include tiger sharks (Galeocerdo cuvier), Galapagos sharks (Carcharhinus galapagensis), and possibly also silvertip sharks (Carcharhinus albimarginatus), though they usually occur at depths greater than those favored by whitetip reef sharks. An 80 cm (31 in) long whitetip reef shark has also been found in the stomach of a giant grouper (Epinephelus lanceolatus), though these groupers are unlikely to be significant predators of this species due to their rarity.[5] Known parasites of the whitetip reef shark include the copepod Paralebion elongatus and the praniza (parasitic) larvae of the isopod Gnathia grandilaris.[9][10] While resting during the day, these sharks have been observed being cleaned by the wrasse Bodianus diplotaenia and the goby Elacatinus puncticulatus. Unusually, there is also a report of seven whitetip reef sharks adopting a cleaning posture (mouth agape and gills flared) in the midst of a swarm of non-cleaning hyperiid amphipods; the mechanical stimulation from the moving amphipods are thought to have evoked this behavior through their similarity to actual cleaner organisms.[11]

Feeding [edit]

The lower jaw and teeth of whitetip reef shark

With its slender, lithe body, the whitetip reef shark specializes in wriggling into narrow crevices and holes in the reef and extracting prey inaccessible to other reef sharks. Alternatively, it is rather clumsy when attempting to take food suspended in open water.[5] This species feeds mainly on bony fishes, including eels, squirrelfishes, snappers, damselfishes, parrotfishes, surgeonfishes, triggerfishes, and goatfishes, as well as octopus, spiny lobsters, and crabs.[2] The whitetip reef shark is highly responsive to the olfactory, acoustic, and electrical cues given off by potential prey, while its visual system is attuned more to movement and/or contrast than to object details.[7][12][13] It is especially sensitive to natural and artificial low-frequency sounds in the 25–100 Hz range, which evoke struggling fish.[8]

Whitetip reef sharks hunt primarily at night, when many fishes are asleep and easily taken. After dusk, groups of sharks methodically scour the reef, often breaking off pieces of coral in their vigorous pursuit of prey.[14] Multiple sharks may target the same prey item, covering every exit route from a particular coral head. Each shark hunts for itself and in competition with the others in its group.[7] Unlike blacktip reef sharks and grey reef sharks, whitetip reef sharks do not become more excited when feeding in groups and are unlikely to be stirred into a feeding frenzy.[7] Despite their nocturnal habits, whitetip reef sharks will hunt opportunistically in daytime.[5] Off Borneo, this species gathers around reef drop-offs to feed on food brought up by the rising current.[15] Off Hawaii, they follow Hawaiian monk seals (Monachus schauinslandi) and attempt to steal their catches.[6] A whitetip reef shark can survive for six weeks without food.[5]

Life history [edit]

Four sharks cruising amongst shallow rock outcrops
Gregarious in nature, whitetip reef sharks are often found in groups.

Like other members of its family, the whitetip reef shark is viviparous; once the developing embryos exhaust their supply of yolk, the yolk sac is converted into a placental connection through which the mother delivers nourishment for the remainder of gestation. Mature females have a single functional ovary, on the left side, and two functional uteruses. The reproductive cycle is biennial.[16]

Mating is initiated when up to five males follow closely behind a female and bite at her fins and body, possibly cued by pheromones indicating the female's readiness.[17] Each male attempts to seize the female by engulfing one of her pectoral fins; at times two males might grasp a female on both sides simultaneously. Once engaged, the sharks sink to the bottom, whereupon the male (or males) rotates one of his claspers forward, inflates the associated siphon sac (a subcutaneous abdominal organ that takes in seawater that is used to flush sperm into the female), and attempts to make contact with the female's vent. In many cases, the female resists by pressing her belly against the bottom and arching her tail; this may reflect mate choice on her part. The male has a limited time in which to achieve copulation, as while he is holding the female's pectoral fin in his mouth he is being deprived of oxygen. On the other hand, if the female is willing, the pair settles side-by-side with their heads pressed against the bottom and their bodies at an upward angle.[18][19]

After a gestation period of 10–13 months, females give birth to litters of 1–6 (usually 2–3) pups. The number of offspring is not correlated with female size; each female produces an estimated average of 12 pups over her entire lifetime.[16] Parturition occurs from May to August (autumn and winter) in French Polynesia, in July (summer) off Enewetak Atoll, and in October (summer) off Australia.[2][16] Females give birth while swimming, making violent twists and turns of their bodies; each pup takes under an hour to fully emerge.[20] The newborns measure 52–60 cm (20–24 in) long and have relatively longer caudal fins than adults. This shark develops slowly compared to other requiem sharks; newborns grow at a rate of 16 cm (6.3 in) per year while adults grow as a rate of 2–4 cm (0.79–1.6 in) per year.[5] Sexual maturity is reached at a length of around 1.1 m (3.6 ft) and an age of 8–9 years, though mature males as small as 95 cm (37 in) long have been recorded from the Maldives, suggesting regional variation in maturation size.[21] On the Great Barrier Reef, males live to 14 years and females to 19 years; the maximum lifespan of this shark may be upwards of 25 years.[5][16] In 2008, a whitetip reef shark produced a single pup through possibly asexual means at the Nyiregyhaza Centre in Hungary; previous instances of asexual reproduction in sharks have been reported in the bonnethead (Sphyrna tiburo) and the blacktip shark (Carcharhinus limbatus).[22]

Human interactions [edit]

Fearless and curious, whitetip reef sharks may approach swimmers closely but are seldom aggressive unless provoked. However, these sharks readily attempt, and quite boldly, to steal catches from spear fishers, which has resulted in several people being bitten in the process.[5] In some places, local whitetip reef sharks have learned to associate the sound of a speargun discharge or a boat dropping anchor with food and respond within seconds.[8] As of 2008, the International Shark Attack File lists two provoked and three unprovoked attacks to this species.[23] Whitetip reef sharks are well-suited to ecotourism diving, and with conditioning they can be hand-fed by divers.[2] In Hawaiian mythology, the fidelity (i.e. "loyalty") of whitetip reef sharks to certain areas of the reef for years at a time may have inspired belief in ʻaumākua, the spirits of family ancestors that take animal form and protect their descendants.[24]

The whitetip reef shark is taken by fisheries operating off Pakistan, India, Sri Lanka, Madagascar, and likely elsewhere, using longlines, gillnets, and trawls. The meat and liver are eaten, though sharks from certain areas present a substantial risk of ciguatera poisoning (especially the liver, which contains a much higher concentration of the toxin than the meat).[2][5] The International Union for Conservation of Nature (IUCN) has assessed this species as Near Threatened, as its numbers have dropped in recent decades due to increasing, and thus far unregulated, fishing pressure in the tropics.[21] Its restricted habitat, low dispersal, and slow reproduction are factors that limit this shark's capacity for recovering from overfishing.[1] On the Great Barrier Reef, populations of whitetip reef sharks in fishing zones have been reduced by 80% relative to no-entry zones. Furthermore, populations in no-take zones, where boats are allowed but fishing prohibited, exhibit levels of depletion comparable to fishing zones due to poaching. Demographic models indicate that these depleted populations will continue to decline by 6.6–8.3% per year without additional conservation measures.[16]

References [edit]

  1. ^ a b Smale, M.J. (2005). Triaenodon obesus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved July 15, 2009.
  2. ^ a b c d e f g h i j k l m Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 535–538. ISBN 92-5-101384-5. 
  3. ^ Randall, J.E., Allen, G.R. and Steene, R.C. (1997). Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press. p. 22. ISBN 0-8248-1895-4. 
  4. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Triaenodon obesus" in FishBase. July 2009 version.
  5. ^ a b c d e f g h i j k l m n Randall, J.E. (1977). "Contribution to the Biology of the Whitetip Reef Shark (Triaenodon obesus)". Pacific Science 31 (2): 143–164. 
  6. ^ a b Carrier, J.C., J.A. Musick and M.R. Heithaus (2004). Biology of Sharks and Their Relatives. CRC Press. pp. 52, 502. ISBN 0-8493-1514-X. 
  7. ^ a b c d e Hobson, E.S. (1963). "Feeding Behavior in Three Species of Sharks". Pacific Science 17: 171–194. 
  8. ^ a b c d Martin, R.A. Coral Reefs: Whitetip Reef Shark. ReefQuest Centre for Shark Research. Retrieved on August 7, 2009.
  9. ^ Bester, C. Biological Profiles: Whitetip Reef Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on August 7, 2009.
  10. ^ Coetzee, M., N.J. Smit, A.S. Grutter and A.J. Davies (June 2008). "A new gnathiid (Crustacea: Isopoda) parasitizing two species of requiem sharks from Lizard Island, Great Barrier Reef, Australia". The Journal of Parasitology 94 (3): 608–615. 
  11. ^ Whitney, N.M. and P.J. Motta (June 2008). "Cleaner host posing behavior of whitetip reef sharks (Triaenodon obesus) in a swarm of hyperiid amphipods". Coral Reefs 27 (2): 363. 
  12. ^ Nelson, D.R. and R.H. Johnson. (1970). Acoustic studies on sharks: Rangiroa Atoll, July 1969. ONR Technical Report 2, No. N00014-68-C-0138.
  13. ^ Yano, K., H. Mori, K. Minamikawa, S. Ueno, S. Uchida, K. Nagai, M. Toda and M. Masuda (June 2000). "Behavioral response of sharks to electric stimulation". Bulletin of Seikai National Fisheries Research Institute 78: 13–30. 
  14. ^ Ferrari, A. and A. Ferrari (2002). Sharks. Firefly Books. pp. 186–187. ISBN 1-55209-629-7. 
  15. ^ Bight, M. (2000). The Private Life of Sharks: The Truth Behind the Myth. Stackpole Books. pp. 123–124. ISBN 0-8117-2875-7. 
  16. ^ a b c d e Robbins, W.D. (2006). Abundance, demography and population structure of the grey reef shark (Carcharhinus amblyrhynchos) and the white tip reef shark (Triaenodon obesus) (Fam. Charcharhinidae). PhD thesis, James Cook University.
  17. ^ Johnson, R.H.; Nelson (1978). "Copulation and possible olfaction-mediated pair formation in two species of carcharhinid sharks". Copeia 1978 (3): 539–542. doi:10.2307/1443626. 
  18. ^ Whitney, N.M., H.L. Pratt (Jr.) and J.C. Carrier (2004). "Group courtship, mating behaviour and siphon sac function in the whitetip reef shark, Triaenodon obesus". Animal Behavior 68 (6): 1435–1442. doi:10.1016/j.anbehav.2004.02.018. 
  19. ^ Tricas, T.C. and E.M. Le Feuvre (1985). "Mating in the reef white-tip shark Triaenodon obesus". Marine Biology 84 (3): 233–237. doi:10.1007/BF00392492. 
  20. ^ Schaller, P. (2006). "Husbandry and reproduction of Whitetip reef sharks Triaenodon obesus at Steinhart Aquarium, San Francisco". International Zoo Yearbook 40 (1): 232–240. doi:10.1111/j.1748-1090.2006.00232.x. 
  21. ^ a b Fowler, S.L., R.D. Cavanagh, M. Camhi, G.H. Burgess, G.M. Cailliet, S.V. Fordham, C.A. Simpfendorfer, and J.A. Musick (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. p. 314. ISBN 2-8317-0700-5. 
  22. ^ Holtcamp, W. (July/August 2009). "Lone Parents: Parthenogenesis in Sharks". BioScience 59 (7): 546–550. doi:10.1525/bio.2009.59.7.3. 
  23. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on August 7, 2009.
  24. ^ Taylor, L.R. (1993). Sharks of Hawaii: Their Biology and Cultural Significance. University of Hawaii Press. pp. 20–21. ISBN 0-8248-1562-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!