Overview

Comprehensive Description

Biology

Occur in shallow neritic areas, over muddy bottoms (Ref. 5217). Also found in brackish estuaries and juveniles are common in lagoons and hyper-saline bays (Ref. 5217). Form large schools close to the shore (Ref. 9987). Feed mainly on crustaceans and small fishes. Spawn in the open sea (Ref. 5217). Larval development is represented by profound changes in body form accompanied by 2 periods of length increase, interspaced by a period of length decrease (Ref. 4639). Noted for their habit of skipping along the surface of the water and for jumping after being hooked (Ref. 5521). Marketed fresh, salted and frozen but considered a second rate food fish (Ref. 3718). Rhynchobothrium bulbifer found in the viscera of the adult (Ref. 37032).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The ladyfish, Elops saurus, is a medium-sized fish with an elongate body covered with small, silvery scales. The overall body color is silver, bluish dorsally with yellowish lower sides and a yellow to white ventral surface. The head is small and pointed, with a large terminal mouth whose maxillary extends well behind the eye. The symmetrical caudal lobes of the tail are long and slender, and the dorsal fin inserts just behind the insertion point of the pelvics (Hoese and Moore 1977, Zale and Merrifield 1989).The scale count along the straight lateral line is 103-120, the dorsal ray count is 21-25, and the anal ray count is 14-17 (Hoese and Moore 1977).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Western Atlantic from Cape Cod (uncommon north of Cape Hatteras) to south Brazil, including Caribbean and Gulf of Mexico. Also Red Sea and Indian and western Pacific oceans (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cape Cod to southern Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Historical accounts of E. saurus outside the Western Atlantic have been erroneously described (e.g., Fraser 1973). The species is only distributed in the Western Atlantic from southern New England (but uncommon north of Cape Hatteras, NC) south to Florida, and throughout the Gulf of Mexico to the Yucatan Peninsula (McBride and Horodysky 2004, McBride et al. 2010). Elops saurus was recently split into two species, E. saurus and E. smithi (McBride et al. 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Cape Cod (USA), Bermuda, and northern Gulf of Mexico to southern Brazil. Questionable occurrence records in the China (Ref. 52360), Taiwan (47843), and Vietnam (Ref. 9706, 46452).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Elops saurus can be found in the western Atlantic from southern New England (but uncommon north of Cape Hatteras, NC) south to Bermuda, Florida, and throughout the Gulf of Mexico to southern Brazil (Zale and Merrifield 1989, FWRI 2006). The species also occurs in the western Pacific and the Indian Ocean (Bigelow and Schroeder 1953).Two phenotypically distinct, sympatric (overlapping distributions) ladyfish stocks occur in Florida waters (McBride and Horodysky 2004). The more northern stock is characterized by a high myomere count while the more southern stock exhibits a low myomere count (Smith 1989). Ladyfish occur throughout the India River Lagoon system. McBride at al. (2001) confirm that the species is broadly distributed in both the Indian River and Banana River basins throughout the year, with larger individuals (> 300 lm SL) more common in the Banana River basin.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rarely recorded around the elbow of Cape Cod, Bermuda, and northern Gulf of Mexico to southern Brazil.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Frimodt, C., 1995; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A. J. Lemus, R. Márquez, J. M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 25 - 29; Analspines: 0; Analsoft rays: 16 - 19; Vertebrae: 73 - 85
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 90 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 10.1 kg (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zale and Merrifield (1989) report that ladyfish attain a maximum length of nearly 1 m (but usually less than 60 cm). Although they can reach a maximum weight of nearly 7 kg, most individuals are less than 1.5 kg (Hoese and Moore 1977).Palko (1984) suggests ladyfish can live as long as 6 years.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 100.0 cm TL; max. weight: 10 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Frimodt, C., 1995; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A. J. Lemus, R. Márquez, J. M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Scales small, more than 100 in lateral line. Gular plate narrow (Ref. 26938). Silvery overall, with bluish on upper surface (Ref. 7251). Branchiostegal rays: 26-33 (Ref. 4639).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Ladyfish belong to an ancestral order of bony fish called the Elopiformes. Megalops atlanticus) belong to the same order, and both species are placed in the same family, Elopidae. Both of these species are herring-like in appearance, but can be distinguished from the clupeids not just by size, but by the presence of a gular plate-a bony structure located at the center of the lower jaw. Ladyfish can be differentiated from tarpon by a smaller body size, thinner profile, and finer body scales (Hoese and Moore 1977).Bonefish (Albula vulpes) belong to Order Elopiformes as well, but they are placed into a separate family, the Albulidae. Bonefish lack the gular plate that the elopids possess, the inferior mouth is smaller than that of ladyfish, the snout somewhat more rounded, and the body profile not as thin (Hoese and Moore 1977, Robbins et al. 1986).Larval ladyfish develop into an elongate, flat, nearly transparent larval type known as a leptocephalus. The leptocephalus is an ancestral larval form that today is found only in ladyfish, tarpon, bonefish, and a number of eel families. All of these species are considered to be among the more ancestral of living teleost fish groups.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Typically in shallow brackish and salt water lagoons and ponds, but up to many miles offshore; most common in bays, lagoons, and mangrove areas (Robins and Ray 1986). Ascends rivers in some areas (open water areas in channels with moderate current, and shallow bars and eddies in river bends in Florida). Pelagic offshore breeder.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occur in shallow neritic areas, over muddy bottoms.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Elops saurus occurs in several coastal and estuarine habitats, including seagrass beds, mangrove marsh, impounded salt marshes and sand flats (Gilmore et al. 1982, McBride et al. 2001). Leptocephalus larvae ingress into estuaries from offshore areas (e.g., Sebastian Inlet) from fall to spring and metamorphose into juveniles (Gehringer 1959, McBride and Horodysky 2004). Larval duration is 27–48 days (Wheeler 2000). Juveniles tend to occur in the lowest salinities available in the estuary, although they are not found in fresh water (McBride et al. 2001). Juveniles grow about 1mm per day based on length frequencies (MacDonald pers. comm. 2011). As the YOY grow, they move to more polyhaline, lower estuarine habitats and they eventually leave the estuary. In total they extend from oligohaline to marine habitats in their first few years (McBride et al. 2001). Depth range for this species is less than 1m to continental shelf depths.

Length frequency analyses suggest that they grow from 20–30 mm to 200–300 mm SL during their first year and that at least three age classes were present throughout the year in estuaries of Florida (McBride et al. 2001). Palko (1984) collected 81 ladyfish from northwest Florida, from 238–604 mm FL. Unvalidated, sectioned otoliths showed 0-6 annuli, suggesting that ladyfish live at least six years. Maximum length recorded is 100 cm TL (Claro 1994).

Elops saurus are presumed to be offshore spawners (Gehringer 1959). Spawning is suggested to occur in the fall (Hildebrand 1943). Newly ingressed metamorphosing larvae feed on copepods and mosquito larvae. Late-metamorphic larvae and juveniles forage on crustaceans and small fishes (Harrington and Harrington 1960, Sekavec 1971).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); brackish; marine; pH range: 0.2; depth range ? - 50 m (Ref. 13325)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 25
  Temperature range (°C): 23.636 - 24.665
  Nitrate (umol/L): 0.325 - 0.793
  Salinity (PPS): 35.209 - 36.231
  Oxygen (ml/l): 4.657 - 4.870
  Phosphate (umol/l): 0.094 - 0.133
  Silicate (umol/l): 0.756 - 1.138

Graphical representation

Depth range (m): 0 - 25

Temperature range (°C): 23.636 - 24.665

Nitrate (umol/L): 0.325 - 0.793

Salinity (PPS): 35.209 - 36.231

Oxygen (ml/l): 4.657 - 4.870

Phosphate (umol/l): 0.094 - 0.133

Silicate (umol/l): 0.756 - 1.138
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 50m.
Recorded at 50 meters.

Habitat: pelagic. Most common in bays, lagoons and mangrove areas. Rarely on coral reefs (Ref. 9710). Forms large school close to the shore (Ref. 9987). Feeds mainly on crustaceans and small fishes. Noted for their habit of skipping along the surface of the water and for jumping after being hooked (Ref. 5521). Valued mainly for sport fishing; not often eaten because the meat is full of small bones (Ref. 9987). Marketed fresh, salted and frozen and generally considered a second rate food fish (Ref. 3718).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pelagic; brackish; marine. Depth range; to 50 m. Occur in shallow neritic areas over muddy bottoms and in brackish estuaries. Juveniles are common in lagoons and hypersaline bays. Form large schools close to the shore.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Frimodt, C., 1995; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A. J. Lemus, R. Márquez, J. M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between offshore spawning areas and coastal waters (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly fishes, also shrimp.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occur in shallow neritic areas, over muddy bottoms (Ref. 5217). Also found in brackish estuaries and juveniles are common in lagoons and hyper-saline bays (Ref. 5217) and coral reefs (Ref. 58534). Form large schools close to the shore (Ref. 9987). Feed mainly on crustaceans and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As adults, Elops saurus are primarily piscivorous midwater predators, with various investigators reporting that fish accounted for between 34 and 94% of stomach contents (FWRI 2006). Decapod crustaceans are also important components of the diet of ladyfish.Stage II and III ladyfish larvae feed almost exclusively on zooplankton. As they grow, juveniles take in increasing amounts of larger prey items such as small fish and shrimp as they grow, simultaneously reducing their reliance on zooplankton (Harrington and Harrington 1961). Competitors: Potential competitors with Elops saurus for food resources is likely to include a number of similarly sized piscivorous species, including tarpon, bonefish, needlefish, and others. Predators: Relatively large size protects adult ladyfish from most would-be predators, although some mortality occurs via predation by piscivorous birds, sharks, dolphins, and alligators (Zale and Merrifield 1989).Pelagic eggs and larvae are susceptible to predation by small fish and carnivorous zooplankton (Zale and Merrifield 1989). Parasites: Corkum (1959) reported parasitic tremetodes of genera Bucephalus and Prosorhynchus living within the intestine of ladyfish collected from the Mississippi Gulf coast. Habitats: Ladyfish can be found in several coastal and estuarine habitats, including seagrass beds, mangrove marsh, and sand flats. Settlement-stage larvae and juveniles occur along beaches and in rivers, canals, and impounded estuarine marshes (Gilmore et al. 1981). Activity Time: Diel activity studies conducted by Sogard et al. (1989) indicate that Elops saurus exhibits a high degree of nocturnal activity, evident as increased capture rates occurred starting at dusk and continued through the first few hours after dark before declining through the later nighttime hours. These authors report that E. saurus was captured exclusively at night at Florida Bay sampling sites with high water clarity, but was caught in low numbers during daylight hours as well where water clarity was low.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feed mainly on crustaceans and small fishes.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Frimodt, C., 1995; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A. J. Lemus, R. Márquez, J. M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

The abundance of Elops saurus in Florida is sufficient to support a recreational fishery as well as an incidental commercial fishery. The estimated total Florida landings (commercial and recreational) of the species in 2005 exceeded 725,000 kg (FWRI 2006).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feed mainly on crustaceans and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawns offshore, the larvae drifting towards the coast where they shelter and grow (Ref. 9987). Leptocephalus larvae are found in salinities as low as 0.0+ to 0.8 ppt (Ref. 75142).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns offshore in late winter or early spring, or throughout year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ladyfish are known to be offshore spawners (McBride et al. 2001). Field larval collections analyzed by Hildenbrand (1943) suggest that offshore spawning occurs in the fall.McBride et al. (2001) indicated that few individuals older than 2-3 years were collected in surveys conducted in Tampa Bay and in the Indian River Lagoon, and nearly all inshore fish of this age were reproductively immature. The authors agree with other published reports (e.g., Hildebrand 1963, Palko1984) suggesting that ladyfish leave the estuaries at 2-3 years of age to mature and spawn offshore.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns offshore, larvae drift towards the coast where they shelter and grow.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Frimodt, C., 1995; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A. J. Lemus, R. Márquez, J. M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Post yolk-sac animals progress through three distinct larval stages (Zale and Merrifield 1989). Stage I is the leptocephalus stage in which individuals are 40-45 mm long (SL), ribbonlike and colorless, with a small head and small fins. Large, fang-like teeth are present though, paradoxically, the gut is not fully formed. Gills and red blood cells are absent. Gas exchange occurs across the body surface and nutrient uptake probably occurs in this manner as well (i.e., osmotrophy).Stage II larvae decrease measurably in length (SL = 18-20 mm) compared to Stage I animals, and they become less ribbon-like over time. Stage III larvae again increase in length before undergoing metamorphosis into the juvenile stage at around SL 30-35 mm. Morphological changes accompanying this transition include an increase in body depth, head and snout length, fin hight/size, and the gradual emergence of body colors analogous to those of juvenile and adult animals (Hildebrand 1934, Zale and Merrifield 1989).Research reports provide varying larval duration estimates, with some authors noting the combined duration of Stages II and III as just 9 days (Gehringer 1959a), while other investigators observed combined Stages II and III durations of roughly 71 days (Alikunhi and Rao 1951).McBride et al. (2001) observed that numbers of new cohorts of late-metamorphic ladyfish larvae in Tampa Bay peaked in April. In the Indian River Lagoon, these authors note the presence of early- and mid-metamorphic larvae from at least December to May, and a peak concentration of late-metamorphic larvae in the spring.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Alikunhi KH and SN Rao. 1951. Notes on the metamorphosis of Elops saurus Linn. and Megalops cyprinoides (Broussonet) with observations on their growth. Journal of the Zoological Society of India 3:99-109.
  • Bigelow HB and WC Schroeder.1953. Fishes of the Gulf of Maine. US Fish and Wildlife Services Fishery Bulletin 74. Volume 53. 577 p.
  • Corkum KC. 1959. Some trematode parasites of fishes from the Mississippi gulf coast. Proceedings of the Louisiana Academy of Science 22:17-29.
  • Eldred B. and WG Lyons. 1966. Larval ladyfish, Elops saurus Linnaeus 1766, (Elopidae) in Florida and adjacent waters. Florida Board of Conservation Marine Laboratory Leaflet Service 4(2). 6 p.
  • FWRI. 2006. Ladyfish, Elops saurus. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. 9 p.
  • Gehringer JW. 1959. Early development and metamorphosis of the ten-pounder, Elops saurus Linnaeus. US Fish and Wildlife Service Fishery Bulletin 59:619-647.
  • Gilmore RG, Jr., Donohoe CJ, Cooke DW, and DJ Herrema. 1981. Fishes of the Indian River Lagoon and adjacent waters, Florida. Harbor Branch Foundation Technical Report 41. 36 p.
  • Govoni JJ and JV Merriner. 1978. The occurrence of ladyfish, Elops saurus, larvae in low salinity water and another record for Chesapeake Bay. Estuaries 1:205-206.
  • Harrington RW, Jr. and ES Harrington. 1961. Food selection among fishes invading a high subtropical salt marsh: from onset of flooding through the progress of a mosquito brood. Ecology 42:646-666.
  • Hildebrand SF. 1943. Notes on the affinity, anatomy and development of Elops saurus Linnaeus. Journal of the Washington Academy of Science 33:90-94.
  • Hildebrand SF. 1963. Family Elopidae: fishes of the western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1963, part 3:123-131.
  • McBride RS, MacDonald TC, Matheson RE Jr., Rydene DA, and PB Hood. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin 99:443-458.
  • McBride RS and AZ Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography 49:1173-1181.
  • Moffett AW and JE Randall. 1957. The Roger Firestone tarpon investigation. University of Miami Marine Laboratory Progress Report 57-22. 18 p.
  • Nelson JS. 1984. Fishes of the World. John Wiley and Sons, NY. 523 p.
  • Palko BJ. 1984. An evaluation of hard parts for age determination of pompano (Trachinotus carolinus), ladyfi sh (Elops saurus), crevalle jack (Caranx hippos), gulf flounder (Paralichthys albigutta), and southern flounder (Paralichthys lethostigma). US Department of Commerce NOAA Technical Memorandum NMFS-SEFC 132. 11 p.
  • Rose CD, Harris AH, and B Wilson. 1975. Extensive culture of penaeid shrimp in Louisiana saltmarsh impoundments. Transactions of the American Fisheries Society 104:296-307.
  • Smith DG. 1980. Early larvae of the tarpon, Megalops atlantica Valenciennes (Pisces: Elopidae), with notes on spawning in the Gulf of Mexico and the Yucatan Channel. Bulletin of Marine Science 30:136-141.
  • Smith DG. 1989. Order Elopiformes; Families Elopidae, Megalopidae, and Albulidae: Leptocephali. Fishes of the Western North Atlantic. Memoirs of the Sears Foundation for Marine Research, Yale University. 1989, part 1:961-972.
  • Snelson FF, Jr. and W.K. Bradley, Jr. 1978. Mortality of fishes due to cold on the east coast of Florida, January, 1977. Florida. Scientist 41:1-12.
  • Sogard SM, Powell GVN, and JG Holmquist. 1989. Utilization by fishes of shallow, seagrass-covered banks in Florida Bay: 2. Diel and tidal patterns. Environmental Biology of Fishes 24:81-92.
  • Springer VG and KD Woodburn. 1960. An ecological study of the fishes of the Tampa Bay area. Florida Board of Conservation Marine Laboratory Professional Paper Service. 1,104 p.
  • Storey M. 1937. The relation between normal range and mortality of fishes due to cold at Sanibel Island, Florida. Ecology 18:10-26.
  • Thompson BA and LA Deegan. 1982. Distribution of ladyfish (Elops saurus) and bonefish (Albula vulpes) leptocephali in Louisiana. Bulletin of Marine Science 32:936-939.
  • Zale AV and SG Merrifield. 1989. Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (South Florida): Ladyfish and Tarpon. US Fish and Wildlife Service Biological Report 82(11.104). US Army Corps of Engineers report TR EL-82-4. 17 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Elops saurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Elops saurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGATTCTTTTCTACTAACCACAAAGACATTGGTACCCTATACCTAATTTTCGGTGCCTGAGCCGGAATAGTCGGGACAGCACTAAGCCTCCTGATCCGAGCCGAATTAAGCCAACCCGGGGCGCTTCTGGGAGAC---GACCAGATTTATAATGTCATCGTCACAGCACACGCCTTTGTAATAATCTTCTTTATAGTAATGCCAATCATAATTGGTGGCTTTGGAAACTGACTGATCCCTCTCATGATCGGAGCCCCTGACATGGCGTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTACCACCCTCTTTCCTGCTGTTGTTGGCCTCTTCTGGAGTGGAAGCAGGAGCGGGGACCGGATGAACCGTCTATCCGCCCCTGGCGGGAAACCTCGCCCACGCGGGAGCATCCGTCGACCTAACCATCTTCTCCCTCCACCTTGCAGGTGTGTCTTCTATCCTGGGTGCTATCAACTTTATTACTACAATTATTAACATGAAACCGCCAGCAATAACACAATACCAAACGCCACTATTCGTTTGAGCAGTACTGATCACCGCCGTTCTTCTCCTCCTATCGCTGCCAGTGCTAGCTGCTGGCATCACAATGCTGCTAACAGACCGAAACCTGAACACAACCTTCTTTGACCCGGCAGGCGGAGGAGACCCAATCCTTTACCAACACCTATTCTGGTTCTTCGGGCACCCAGAAGTATACATTCTAATTCTCCCAGGCTTCGGAATAATCTCACACATCGTAGCCTACTATGCAGGCAAAAAAGAACCATTCGGCTACATGGGCATAGTATGGGCAATGATGGCTATTGGTCTTCTTGGCTTTATCGTATGGGCACACCACATGTTCACGGTAGGAATGGATGTAGACACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Adams, A., Guindon, K., Horodysky, A., MacDonald, T., McBride, R., Shenker, J. & Ward, R.

Reviewer/s
Harwell, H. & Raynal, M.

Contributor/s

Justification
Historical accounts of E. saurus outside the Western Atlantic have been erroneously described (e.g., Fraser 1973). The species is only distributed in the Western Atlantic from southern New England (but uncommon north of Cape Hatteras, NC) south to Florida, and throughout the Gulf of Mexico to the Yucatan Peninsula (McBride and Horodysky 2004, McBride et al. 2010). Elops saurus was recently split into two species, E. saurus and E. smithi (McBride et al. 2010). There is no formal stock assessment for this species but there are historic time series data for commercial and recreational catches as well as fishery-independent time series data in the United States, particularly Florida. Its early stages use estuary and lagoonal habitats, which are prone to anthropogenic alterations. However, population trends are currently stable and this species is exhibits a broad range of habitat plasticity. Therefore, we list this species as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are historic time series data for commercial (fish meal, human consumption) and recreational catches as well as fishery-independent time series data of E. saurus in the southeast USA. Elops saurus is common throughout Florida (McBride et al. 2001). During 2007, the total annual landings of ladyfish in Florida were 1,110,012 pounds; most (75%) were landed by the commercial fishery. Landings were greater on the Gulf coast, where about 92% of the statewide landings were made in 2007. The recent discovery of E. smithi, a sympatric congener in with E. saurus in the southeast USA, does not influence the interpretation of these landings because the newly recognized species most likely comprises only 1–2% of the catch (McBride and Horodysky 2004).

Most USA commercial landings of E. saurus occur along Florida’s Gulf of Mexico coast, where landings rose steadily from the 1960s to peak at 2630 MT in 1999 (http://www.st.nmfs.noaa.gov/st1/commercial/). Due to Florida’s state-wide prohibition of entangling nets in 1995, landings declined to 500 MT in 2009. Recently, the landings attributed to other Gulf of Mexico states have increased, and since 2000, landings attributed throughout the Gulf have averaged 625 MT (+ 227 MT s.d.) (http://www.st.nmfs.noaa.gov/st1/commercial/). These landings over the last decade are similar to landings from the 1960s, suggesting that the effect of Florida’s net ban on restricting effort have contributed to relative stability in the commercial landings of E. saurus. Total annual commercial landings on the Atlantic coast are a negligible part of the statewide catch, reaching 0.15 MT in 2005. Landings rates for the Atlantic coast commercial fisheries have slowly declined since 1996.

Most USA recreational landings of E. saurus also occur in the Gulf of Mexico (http://www.st.nmfs.noaa.gov/st1/recreational). Recreational landings increased markedly following the late 1990s, in both Gulf of Mexico and Atlantic fishing regions, possibly due to Florida’s net ban restricting the availability of commercial product (Adams et al. in review).

Indices of abundance from Florida's Fisheries-Independent Monitoring program's (1996–2010) using a consistent gear (183 m haul seine) indicate that the stocks were stable from 1996–2006 in each of the sampled estuaries in Florida (northeast Florida, northern Indian River Lagoon, southern Indian River Lagoon, Charlotte Harbor, Tampa Bay, Cedar Key, Appalachicola Bay). No formal stock assessment for ladyfish is available at this time (MacDonald pers. comm. 2011).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Elops saurus utilizes estuarine areas and hyper-saline lagoons; changes in the the quality of this habitat may affect this species' population dynamics. Although this species may not be closely associated with any single habitat, it may be adversely affected by urbanization.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Florida, the prohibition of the use of tarp nets and entangling nets is in place for the commercial fishery of this species (Florida Fish and Wildlife Conservation Commission 2008). Its distribution may overlap with marine reserves in parts of its range. There are no recreational size or bag limits in place (MacDonald pers. comm. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; bait: usually; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Elops saurus

The ladyfish or tenpounder, (Elops saurus) is a species in the genus Elops, the only genus in the monotypic family Elopidae.

Description[edit]

Like other species in its genus, the ladyfish has a long, slender, rounded body covered with silvery scales. Its mouth is terminal and the tail is deeply forked. The species can be distinguished by counting the number of gill rakers and vertebrae.[1]

Distribution[edit]

The ladyfish is distributed in the western North Atlantic Ocean from New England to Florida, and the Gulf of Mexico.[1] Its distribution overlaps with the malacho (Elops smithi) in the southeast US and the southern Gulf of Mexico.[2]

Biology[edit]

Like other members of the Elopidae, the ladyfish is a pelagic fish that spawns in the sea, but little is known about this marine phase. The larvae, which are transparent and laterally compressed, are dispersed inshore and enter embayments, where they live for 2 to 3 yr.[2][3] The juveniles are euryhaline, or tolerant to a wide range of salinity, so these embayments may be low-salinity estuaries or hypersaline lagoons.[4] Subadults move into the lower reaches of the embayments, and upon maturation, proceed to offshore, marine habitats.

Threats[edit]

This species uses estuarine areas and hypersaline lagoons; changes in the quality of these habitats may affect this species' population dynamics. Although this species may not be closely associated with any single habitat, it may be adversely affected by development and urbanization. [5]

References[edit]

  1. ^ a b McBride, Richard S., et al. 2012. A new species of ladyfish, of the genus Elops (Elopiformes: Elopidae), from the western Atlantic Ocean. Zootaxa. 2346: 29-41.
  2. ^ a b McBride, Richard S. and A. Z. Horodysky. 2004. Mechanisms maintaining sympatric distributions of two ladyfish (Elopidae: Elops) morphs in the Gulf of Mexico and western North Atlantic Ocean. Limnology and Oceanography. 49(4): 1173-1181.
  3. ^ Gehringer, J. W. 1959. Early development and metamorphosis of the ten-pounder Elops saurus Linnaeus. Fishery Bulletin. 59: 618-647.
  4. ^ McBride, Richard S., et al. 2001. Nursery habitats for ladyfish, Elops saurus, along salinity gradients in two Florida estuaries. Fishery Bulletin. 99(3): 443-458.
  5. ^ Adams, A. J., et al. 2013. Global conservation status and research needs for tarpons (Megalopidae), ladyfishes (Elopidae) and bonefishes (Albulidae). Fish and Fisheries. Early View (Online Version of Record published before inclusion in an issue.)


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors have recognized six species in the genus, whereas others have suggested the possibility of a single cosmopolitan species. Nelson (1984) stated that the genus included about five species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!