Overview

Comprehensive Description

Biology

Common in inshore waters and in shallow bays, sometimes in deep water (Ref. 2850). Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 7.0-8.5 cm long and 6.5-7.6 cm wide (Ref. 41300).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: skate (English), raya (Espanol)
 
Raja inornata Jordan & Gilbert, 1881

California skate

Rhomboidal disc of flattened, pointed head, body and pectoral fins snout rigid, long, sharply pointed, with concave sides at its base, its length 12.3-16.4% of TL; 36-40 rows of teeth on upper jaw; large spiracles behind eyes; pelvic fins deeply notched, with 2 distinct lobes, rear one larger; spines on rear borders only of ventral side; 2 small dorsal fins at rear of tail, no tail fin; spines on disc small, thin, not grooved, with oval bases; no spines around or just behind eyes or on back; 1 row of spines along tail, extending onto pelvics and sometimes onto mid-back; top of disc with scattered small denticles.


Olive brown above, tan below; sometimes dark mottling, occasionally a dark ocellus or spots at base of each pectoral.


Size: 76 cm.

Habitat: soft bottoms, in bays.

Depth: 13-1600 m.

Canada to the western and NE Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Strait of Juan de Fuca in Canada and USA to central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Northeast and eastern central Pacific: known from the Straits of Juan de Fuca off British Colombia, Canada and Washington, USA, as well as Oregon, California, and central Baja California, Mexico. Also, from the Gulf of California (Benson et al. 2001, Miller and Lea 1972, McEachran and Notobartolo di Sciara 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 13 (S) - 1600 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 76.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Raja inornata
Catalog Number: USNM 26926
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Raja inornata
Catalog Number: USNM 26974
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1882. Proceedings of the United States National Museum. 4 (194): 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Raja inornata
Catalog Number: USNM 16704
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Stone
Locality: No Data
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 18 - 671 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found on soft bottoms at depths of 17?671 m (Ebert 2003, Miller and Lea 1972). Males are reported to mature at about 47 cm total length (TL) and females at about 52 cm TL (Ebert 2003). The maximum reported size is 76 cm TL (Jordan and Gilbert 1881). Size at birth is 15?23 cm TL (Ebert 2003). They are reported to feed on small benthic invertebrates including polychaete worms and shrimp (Ebert 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3 - 136.21
  Temperature range (°C): 18.831 - 18.831
  Nitrate (umol/L): 0.440 - 0.440
  Salinity (PPS): 33.781 - 33.781
  Oxygen (ml/l): 5.364 - 5.364
  Phosphate (umol/l): 0.411 - 0.411
  Silicate (umol/l): 2.488 - 2.488

Graphical representation

Depth range (m): 3 - 136.21
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 18 - 671m.
From 18 to 671 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Benthic, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Raja inornata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTCTACTTAATCTTTGGTGCCTGAGCAGGCATGGTCGGAACTGGCCTAAGTCTTTTAATCCGAGCAGAACTAAGTCAGCCCGGGTCCCTCCTGGGTGATGATCAGATTTATAATGTCATTGTTACAGCCCATGCCTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATCGGGGGGTTTGGTAATTGACTCGTCCCCTTAATAATTGGCTCCCCAGACATGGCCTTCCCACGCATAAATAATATAAGCTTTTGACTTTTACCCCCCTCTTTTCTCCTCCTCCTAGCCTCCGCCGGGGTTGAAGCCGGAGCCGGGACAGGTTGAACTGTCTACCCCCCCTTGGCAGGAAACCTAGCTCATGCAGGGGCCTCCGTAGACTTAACAATCTTCTCTCTTCACTTAGCAGGTGTTTCATCCATTCTAGCCTCCATTAACTTCATCACCACAATTATTAACATAAAACCACCAGCAATCTCTCAGTACCAAACACCCTTATTTGTGTGATCAATTCTTGTCACAACTGTCTTACTTCTTATGGCCCTCCCGGTTCTGGCAGCCGGCATCACCATACTACTCACGGACCGTAATCTCAACACGACTTTCTTCGACCCCGCTGGAGGAGGGGACCCCATCCTGTACCAGCACCTATTCTGATTCTTCGGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Raja inornata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Robinson, H.J., Ebert, D.A. & Cailliet, G.M.

Reviewer/s
Valenti, S.V., Kulka, D.W. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The California Skate (Raja inornata) is found at depths of 17?671 m on the continental shelf of the northeast and eastern central Pacific. It occurs from the Straits of Juan de Fuca, southwards to central Baja California, Mexico, with a disjunct population in the Gulf of California. Very little is known about this skate and no detailed life history studies have been conducted. It is often misidentified with other hardnose skates from the northeast and eastern central Pacific, precluding the collection of species-specific catch data. The species is a utilized bycatch in commercial longline and trawl fisheries and is one of three commercially important skate species in California. Total annual landings for unspecified skate species in California declined from 577 t and 633 t in 2000 and 2001 to between 82?125 t from 2002?2005. The proportion of this species in the catches is not known. Effort in the California trawl fishery has recently reduced and a network of proposed marine protected areas is being instigated (2007) in response to declining fish stocks. Fishing pressure on this species has therefore likely reduced. However, no data are available to determine past population trends in this species it is assessed as Data Deficient at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Nothing is known on its population structure or status. Skates are generally not identified to species level and are often misidentified, precluding the collection of accurate species-specific catch data. However, extensive surveys and collation of catch statistics for northeast and eastern central Pacific waters (including California, Oregon, and Washington) have been conducted (D. Ebert pers. obs. 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Usually a utilized bycatch in commercial longline and trawl fisheries (Martin and Zorzi 1993). One of three commercially important skate species in California and it is marketed for human consumption (Rodel and Ripley 1950, Matin and Zorzi 1993). Total annual commercial landings data into California for the grouped category ?Skate, unspecified? indicate that landings declined from ~577 t and ~633 t in 2000 and 2001 to ~82 t in 2002. Landings then fluctuated between ~12 t and ~95 t from 2003?2005 (California Department of Fish and Game 2007). However, the proportion of this species in the catches is not known. Given that this species appears to occur on the continental shelf it is likely not as affected as other species may have been, such as the longnose skate, Raja rhina.

The trawl fishery in California has been slowly closing and a network of marine protected areas (MPAs) in Californian waters is being instigated, in response to declines in rockfish populations which overlap with the habitat of this species (D. Ebert pers. obs. 2007). Most trawlers now have to work in deeper water and mostly in central and northern California. Southern California is largely closed at this time (D. Ebert pers. obs. 2007). Effort in the trawl fishery in California waters has therefore reduced and not nearly as many are being taken as once might have been (D. Ebert pers. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Measures in place

California?s Marine Life Protection Act, effective from 21st September 2007, establishes a Central Coast Region, composed of 29 marine protected areas (MPAs) off the state. (See: http://www.dfg.ca.gov/mlpa/newsroom_083107.asp for further details). The 29 sites within the Central Coast MPA series represent approximately 204 square miles (roughly 18 percent) of state waters in the Central Coast Study Region. The implementation of these MPAs in currently ongoing.

Southern California waters are largely closed to trawl fishing at this time (D. Ebert pes. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!