Overview

Comprehensive Description

Raja inornata Jordan & Gilbert, 1881

Description: The egg cases of Raja inornata (Figure 9) are very small, 68 to 73 mm in length from anterior to posterior apron borders, with MAW about 73-77% of ECL. Egg case surfaces finely striated, without fibrous covering, and very smooth to the touch. LKW is very broad, about 17-25% of MAW, and extending length of case including outer edge of horns; keels absent or very minute along inner horn edge. Attachment fibers not present. Anterior apron border broad, concave, anterior horns about 34-52% of ECL, curling ventrally, and flattening and hook-like towards tips. Posterior apron nearly straight, broad, transverse, and about 4-6 mm wider than anterior apron width. Posterior horns relatively short, about one-half ECL, curved, and flattening towards tips. Preserved egg case color dark brown becoming lighter on keels.

Remarks: The present description of this egg case differs from the original description by Cox (1963) in that we did not observe attachment fibers to be present in any of the specimens examined. Also, Cox (1963) did not comment on the broad lateral keels of these egg cases which we found to be a good characteristic for separating between similar looking egg cases, but from different species.

Material examined: Ten egg cases all deposited between July and August 2005 by R. inornata specimens held at the Monterey Bay Aquarium. Two of these egg cases accessioned as CAS 224342.

  • David A. Ebert, Chante D. Davis (2007): Descriptions of skate egg cases (Chondrichthyes: Rajiformes: Rajoidei) from the eastern North Pacific. Zootaxa 1393, 1-18: 11-12, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:0C16005C-21BC-4252-823E-C83515FCFF28
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: skate (English), raya (Espanol)
 
Raja inornata Jordan & Gilbert, 1881

California skate

Rhomboidal disc of flattened, pointed head, body and pectoral fins snout rigid, long, sharply pointed, with concave sides at its base, its length 12.3-16.4% of TL; 36-40 rows of teeth on upper jaw; large spiracles behind eyes; pelvic fins deeply notched, with 2 distinct lobes, rear one larger; spines on rear borders only of ventral side; 2 small dorsal fins at rear of tail, no tail fin; spines on disc small, thin, not grooved, with oval bases; no spines around or just behind eyes or on back; 1 row of spines along tail, extending onto pelvics and sometimes onto mid-back; top of disc with scattered small denticles.


Olive brown above, tan below; sometimes dark mottling, occasionally a dark ocellus or spots at base of each pectoral.


Size: 76 cm.

Habitat: soft bottoms, in bays.

Depth: 13-1600 m.

Canada to the western and NE Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Common in inshore waters and in shallow bays, sometimes in deep water (Ref. 2850). Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 7.0-8.5 cm long and 6.5-7.6 cm wide (Ref. 41300).
  • McEachran, J.D. and K.A. Dunn 1998 Phylogenetic analysis of skates, a morphologically conservative clade of elasmobranchs (Chondrichthyes: Rajidae). Copeia 1998(2):271-290. (Ref. 27314)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Northeast and eastern central Pacific: known from the Straits of Juan de Fuca off British Colombia, Canada and Washington, USA, as well as Oregon, California, and central Baja California, Mexico. Also, from the Gulf of California (Benson et al. 2001, Miller and Lea 1972, McEachran and Notobartolo di Sciara 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Juan de Fuca Strait in Canada and USA to central Baja California, Mexico.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 13 (S) - 1600 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 76.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850))
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Raja inornata
Catalog Number: USNM 26926
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Raja inornata
Catalog Number: USNM 26974
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1882. Proceedings of the United States National Museum. 4 (194): 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Raja inornata
Catalog Number: USNM 16704
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Stone
Locality: No Data
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found on soft bottoms at depths of 17-671 m (Ebert 2003, Miller and Lea 1972). Males are reported to mature at about 47 cm total length (TL) and females at about 52 cm TL (Ebert 2003). The maximum reported size is 76 cm TL (Jordan and Gilbert 1881). Size at birth is 15-23 cm TL (Ebert 2003). They are reported to feed on small benthic invertebrates including polychaete worms and shrimp (Ebert 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 13 - 1600 m (Ref. 96339)
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3 - 136.21
  Temperature range (°C): 18.831 - 18.831
  Nitrate (umol/L): 0.440 - 0.440
  Salinity (PPS): 33.781 - 33.781
  Oxygen (ml/l): 5.364 - 5.364
  Phosphate (umol/l): 0.411 - 0.411
  Silicate (umol/l): 2.488 - 2.488

Graphical representation

Depth range (m): 3 - 136.21
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 18 - 671m.
From 18 to 671 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Benthic, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Raja inornata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTCTACTTAATCTTTGGTGCCTGAGCAGGCATGGTCGGAACTGGCCTAAGTCTTTTAATCCGAGCAGAACTAAGTCAGCCCGGGTCCCTCCTGGGTGATGATCAGATTTATAATGTCATTGTTACAGCCCATGCCTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATCGGGGGGTTTGGTAATTGACTCGTCCCCTTAATAATTGGCTCCCCAGACATGGCCTTCCCACGCATAAATAATATAAGCTTTTGACTTTTACCCCCCTCTTTTCTCCTCCTCCTAGCCTCCGCCGGGGTTGAAGCCGGAGCCGGGACAGGTTGAACTGTCTACCCCCCCTTGGCAGGAAACCTAGCTCATGCAGGGGCCTCCGTAGACTTAACAATCTTCTCTCTTCACTTAGCAGGTGTTTCATCCATTCTAGCCTCCATTAACTTCATCACCACAATTATTAACATAAAACCACCAGCAATCTCTCAGTACCAAACACCCTTATTTGTGTGATCAATTCTTGTCACAACTGTCTTACTTCTTATGGCCCTCCCGGTTCTGGCAGCCGGCATCACCATACTACTCACGGACCGTAATCTCAACACGACTTTCTTCGACCCCGCTGGAGGAGGGGACCCCATCCTGTACCAGCACCTATTCTGATTCTTCGGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Raja inornata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Robinson, H.J., Ebert, D.A. & Cailliet, G.M.

Reviewer/s
Valenti, S.V., Kulka, D.W. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The California Skate (Raja inornata) is found at depths of 17-671 m on the continental shelf of the northeast and eastern central Pacific. It occurs from the Straits of Juan de Fuca, southwards to central Baja California, Mexico, with a disjunct population in the Gulf of California. Very little is known about this skate and no detailed life history studies have been conducted. It is often misidentified with other hardnose skates from the northeast and eastern central Pacific, precluding the collection of species-specific catch data. The species is a utilized bycatch in commercial longline and trawl fisheries and is one of three commercially important skate species in California. Total annual landings for unspecified skate species in California declined from 577 t and 633 t in 2000 and 2001 to between 82-125 t from 2002-2005. The proportion of this species in the catches is not known. Effort in the California trawl fishery has recently reduced and a network of proposed marine protected areas is being instigated (2007) in response to declining fish stocks. Fishing pressure on this species has therefore likely reduced. However, no data are available to determine past population trends in this species it is assessed as Data Deficient at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Nothing is known on its population structure or status. Skates are generally not identified to species level and are often misidentified, precluding the collection of accurate species-specific catch data. However, extensive surveys and collation of catch statistics for northeast and eastern central Pacific waters (including California, Oregon, and Washington) have been conducted (D. Ebert pers. obs. 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Usually a utilized bycatch in commercial longline and trawl fisheries (Martin and Zorzi 1993). One of three commercially important skate species in California and it is marketed for human consumption (Rodel and Ripley 1950, Matin and Zorzi 1993). Total annual commercial landings data into California for the grouped category "Skate, unspecified" indicate that landings declined from ~577 t and ~633 t in 2000 and 2001 to ~82 t in 2002. Landings then fluctuated between ~12 t and ~95 t from 2003-2005 (California Department of Fish and Game 2007). However, the proportion of this species in the catches is not known. Given that this species appears to occur on the continental shelf it is likely not as affected as other species may have been, such as the longnose skate, Raja rhina.

The trawl fishery in California has been slowly closing and a network of marine protected areas (MPAs) in Californian waters is being instigated, in response to declines in rockfish populations which overlap with the habitat of this species (D. Ebert pers. obs. 2007). Most trawlers now have to work in deeper water and mostly in central and northern California. Southern California is largely closed at this time (D. Ebert pers. obs. 2007). Effort in the trawl fishery in California waters has therefore reduced and not nearly as many are being taken as once might have been (D. Ebert pers. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Measures in place

California?s Marine Life Protection Act, effective from 21st September 2007, establishes a Central Coast Region, composed of 29 marine protected areas (MPAs) off the state. (See: http://www.dfg.ca.gov/mlpa/newsroom_083107.asp for further details). The 29 sites within the Central Coast MPA series represent approximately 204 square miles (roughly 18 percent) of state waters in the Central Coast Study Region. The implementation of these MPAs in currently ongoing.

Southern California waters are largely closed to trawl fishing at this time (D. Ebert pes. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
  • McEachran, J.D. 1995 Rajidae. Rayas. p. 773-777. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para los Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9261)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!